Subject:
All Disciplines Arts & Humanities Biology & Life Sciences Business & Economics Chemistry & Materials Science Computer Science & Mathematics Engineering Environmental & Earth Sciences Medicine & Pharmacology Physical Sciences Public Health & Healthcare Social Sciences
Sort:
Most Viewed Latest Alphabetical (A-Z) Alphabetical (Z-A)
Filter:
All Topic Review Biography Peer Reviewed Entry Video Entry
Topic Review
Cyanomethylation Reaction
Cyanomethylation is very useful in organic synthesis because the cyano groups can be hydrolyzed to carboxylic acids and reduced to amines, from which other functional groups can be derived. In addition, the cyano group is the structural unit of many drugs, such as piritramide, diphenozlate, and gallopamil, while acetonitrile is an ideal source of the cyanomethyl functional group due to the difficulty in breaking the C-CN bond. 
  • 684
  • 08 May 2023
Topic Review
Macroalgae Specialized Metabolites with Anti-Inflammatory Activity
The seaweeds or macroalgae belong to the basic tropic level in the marine water ecosystem and are responsible, with microalgae, for the balance of the abiotic and biotic factors of marine life. Seaweeds represent a valuable resource of bioactive compounds associated with anti-inflammatory effects and offer great potential for the development of new anti-inflammatory drugs.
  • 681
  • 05 Jan 2023
Topic Review
Synthesis of Monoterpene Thiols
Thiols are one of the most convenient synthons in the synthesis of organosulfur compounds. The typical methods to prepare monoterpene thiols include the electrophilic addition of H2S or dithiols to the double bond of monoterpenes; nucleophilic substitution of halides; tosylates/mesylates obtained from corresponding monoterpene alcohols; thia-Michael addition of S-nucleophiles to α,β-unsaturated ketones; nucleophilic epoxide ring opening; nucleophilic substitution of the activated methylene protons; and reduction of sulfochlorides, dithiolanes, thiiranes, and sultones.
  • 681
  • 07 Nov 2023
Topic Review
Biocatalyzed Redox Processes Employing Green Reaction Media
Biocatalysis can be defined in a broad sense as the mediation of chemical reactions by means of biological systems, including isolated enzymes, whole cells or cell-free extracts. In some circumstances, the aqueous buffer medium normally employed in biocatalytic procedures is not the best option to develop these processes, due to solubility and/or inhibition issues, requiring biocatalyzed redox procedures to circumvent these drawbacks, by developing novel green non-conventional media, including the use of biobased solvents, reactions conducted in neat conditions and the application of neoteric solvents such as deep eutectic solvents. 
  • 679
  • 05 Jul 2022
Topic Review
Wild Boar Carcass Characteristics and Meat Quality
Globally, wild boar is a primary food resource, mostly for remote rural communities outside of large urban centers located in Latin America, Asia, and Africa. In Chile, the production of meat from European wild boar (Sus scrofa L.) is expanding together with the export of this “exotic” meat. Furthermore, in the Finno-Scandinavian peninsula, and central and Mediterranean Europe, wild boar (Sus scrofa) and other game species meat (reindeer, red deer, roe deer, fallow deer, moose, and chamois) can be found in local restaurants and fairs, indicating an already consolidated gastronomic interest in this type of meat.
  • 678
  • 24 Jul 2023
Topic Review
Heteroelement Analogues of Benzoxaborole
Heteroelement analogues of benzoxaboroles constitute an interesting class of boracyclic compounds and may offer the opportunity for various applications while retaining high stability arising from the presence of a strong B-O bond in the ring structure. The replacement of a carbon atom in the boracycle or an adjacent benzene ring with a heteroatom may result in a significant change of structural behaviour. Moreover,  physicochemical properties, including solubility, lipophilicity, hydrolytic stability, boron Lewis acidity, and others, can be modified. The aim of this review is to highlight several emerging groups of boracyclic systems which comprise various heteroelement atoms such as another boron, silicon, tin, nitrogen, phosphorus, and iodine. The information on synthesis and properties of such systems is complemented by presentation of their practical potential encompassing especially organic synthesis and catalysis as as medicinal chemistry. 
  • 674
  • 22 Sep 2021
Topic Review
Biosynthesis of Aurones
Natural products are a boundless source for the development of pharmaceutical agents against a wide range of human diseases. Accordingly, naturally occurring aurones possess various biological benefits, such as anticancer, antioxidant, antimicrobial, antidiabetic, anti-inflammatory, antiviral and neuroprotective effects. In addition, various studies have revealed that aurones are potential templates for the regulation of diabetes mellitus and its associated complications. Likewise, certain aurones and their analogues have been found to be remarkable kinase inhibitors of DARK2, PPAR-γ, PTPM1, AGE, α-amylase and α-glucosidase, which represents a promising approach for the treatment of chronic metabolic disorders such as diabetes. 
  • 669
  • 01 Nov 2023
Topic Review
Corey-Seebach Reagent in the 21st Century
The Corey-Seebach reagent plays an important role in organic synthesis because of its broad synthetic applications. The Corey-Seebach reagent is formed by the reaction of an aldehyde or a ketone with 1,3-propane-dithiol under acidic conditions, followed by deprotonation with n-butyllithium. A large variety of natural products (alkaloids, terpenoids, and polyketides) can be accessed successfully by utilizing this reagent.
  • 660
  • 30 May 2023
Topic Review
Marine Endoperoxide Norterpenes
Organic extracts of marine invertebrates, mainly sponges, from seas all over the world are well known for their high in vitro anticancer and antibiotic activities which make them promising sources of compounds with potential use as pharmaceutical leads. Most of the structures discovered so far have a peculiar structural feature in common: a 1,2-dioxane ring. This is a highly reactive heterocycle that can be considered as an endoperoxide function. Together with other structural features, this group could be responsible for the strong biological activities of the substances present in the extracts. Numerous research programs have focused on their structural elucidation and total synthesis since the seventies. As a consequence, the number of established chiral centres and the similarity between different naturally occurring substances is increasingly higher. Most of these compounds have a terpenoid nature, mainly diterpene and sesterterpene, with several peculiar structural features, such as the loss of one carbon atom. Although there are many reviews dealing with the occurrence of marine peroxides, their activities, or potential pharmaceutical uses, no one has focused on those having a terpene origin and the endoperoxide function. We present here a comprehensive review of these compounds paying special attention to their structural features and their biological activity.
  • 651
  • 15 Dec 2021
Topic Review
Encapsulation of Dyes in Luminescent Metal-Organic Frameworks
White light emitting diodes (WLEDs), as solid-state lighting sources, have attracted increasing attention in the past decades owing to their potential applications in displays and lighting. WLEDs are energy saving and environmentally friendly, and have higher luminous efficiency than conventional incandescent and fluorescent lamps. Moreover, WLEDs emit polychromatic light rather than monochromatic light that was emitted by traditional light emitting diodes (LEDs).
  • 641
  • 29 Oct 2021
Topic Review
Polyphenols in Humiria balsamifera (Aubl)
Humiria balsamifera (Aubl), commonly known as “mirim”, is a plant of the Humiriaceae family, which consists of 39 species divided between eight genera: Duckesia, Endopleura, Humiria, Humiriastrum, Hylocara, Sacoglottis, Schistostemon, and Vantenea. This study aimed to characterize H. balsamifera extracts by LC-MS/MS and evaluate their antimicrobial potential through in vitro and in vivo assays. 
  • 639
  • 08 Nov 2021
Topic Review
G-Quadruplex DNA Catalysts
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Modified oligonucleotides (ODNs) based on this sequence  were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess.
  • 638
  • 10 Feb 2022
Topic Review
Synthesis of Pyran Derivatives
Heterogeneous catalysis (HC) has become a valuable means for designing sustainable production protocols to obtain superior intermediates, synthons, and potent bioactive heterocycles. The heterogeneous catalysts proved economical and eco-friendly due to the effectiveness of non-hazardous metals for constructing nanomaterials for atom-economical organic reactions. Heterogeneous catalysts significantly affected scientific and industrial innovations due to their tuneable textural properties, flexible acid-base characteristics, higher thermal stability, and improved reusability, with their excellent performance over their enormous counterparts.
  • 636
  • 18 Oct 2022
Topic Review
Medicinally Viable Plants of the Genus Tylophora
Plants of the genus Tylophora have commonly been used in traditional medicine in various communities, especially in the tropical and subtropical regions of climatic zones. Of the nearly 300 species reported in the Tylophora genus, eight are primarily used in various forms to treat a variety of bodily disorders based on the symptoms. Certain plants from the genus have found use as anti-inflammatory, anti-tumor, anti-allergic, anti-microbial, hypoglycemic, hypolipidemic, anti-oxidant, smooth muscle relaxant, immunomodulatory, and anti-plasmodium agents, as well as free-radical scavengers. Pharmacologically, a few plant species from the genus have exhibited broad-spectrum anti-microbial and anti-cancer activity, which has been proven through experimental evaluations. Some of the plants in the genus have also helped in alcohol-induced anxiety amelioration and myocardial damage repair. The plants belonging to the genus have also shown diuretic, anti-asthmatic, and hepato-protective activities. Tylophora plants have afforded diverse structural bases for secondary metabolites, mainly belonging to phenanthroindolizidine alkaloids, which have been found to treat several diseases with promising pharmacological activity levels. 
  • 635
  • 09 Mar 2023
Topic Review
Solar Photooxygenations for Chemical Manufacturing
Photooxygenation reactions involving singlet oxygen (1O2) are utilized industrially as a mild and sustainable access to oxygenated products. Due to the usage of organic dyes as photosensitizers, these transformations can be successfully conducted using natural sunlight. Modern solar chemical reactors enable outdoor operations on the demonstration (multigram) to technical (multikilogram) scales and have subsequently been employed for the manufacturing of fine chemicals such as fragrances or biologically active compounds. This review highlights examples of solarphotooxygenations for the manufacturing of industrially relevant target compounds and discusses current challenges and opportunities of this sustainable methodology.
  • 631
  • 29 Mar 2021
Topic Review
Spirocyclic Motifs in Natural Products
Natural products play the central role in drug discovery due to their inherent biological activity and because have a wide span of structural diversity. Spirocyclic compounds have also occupied a special place in medicinal chemistry. Spirocycles are thought to possess a good balance of conformational rigidity and flexibility to be, on one hand, free from absorption and permeability issues characteristic of conformationally more flexible, linear scaffolds. On the other hand, spirocycles are more conformationally flexible compared to, for example, flat aromatic heterocycles and can adapt to many proteins as biological targets; thus, increasing the chances of finding bioactive hits. Spirocycles are distinctly three-dimensional and initial hits can be further optimized via manipulation of the molecular periphery whose three-dimensional positioning is well defined. 
  • 625
  • 25 Apr 2022
Topic Review
Heteroaromatic Diazirines in Material and Medicinal Chemistry
In materials (polymer) science and medicinal chemistry, heteroaromatic derivatives play the role of the central skeleton in development of novel devices and discovery of new drugs. On the other hand, (3-trifluoromethyl)phenyldiazirine (TPD) is a crucial chemical method for understanding biological processes such as ligand–receptor, nucleic acid–protein, lipid–protein, and protein–protein interactions. In particular, use of TPD has increased in materials science to create novel electric and polymer devices with comparative ease and reduced costs. Therefore, a combination of heteroaromatics and (3-trifluoromethyl)diazirine is a promising option for creating better materials and elucidating the unknown mechanisms of action of bioactive heteroaromatic compounds.
  • 625
  • 15 Feb 2023
Topic Review
C-C and C-Heteroatom Bonds Construction
Acyl-containing organic compounds, including ketones, esters, amides, and so forth, are a huge library of widespread chemical feedstocks which play a vital role in countless fields such as pharmaceuticals, natural products, advanced materials, and fine chemicals.
  • 624
  • 28 Dec 2022
Topic Review
The Lifetime of Organic Light-Emitting Diodes
Organic light-emitting diodes (OLEDs) have emerged as a promising technology for various applications owing to their advantages, including low-cost fabrication, flexibility, and compatibility. However, a limited lifetime hinders the practical application of OLEDs in electronic devices. OLEDs are prone to degradation effects during operation, resulting in a decrease in device lifetime and performance. 
  • 621
  • 29 Nov 2023
Topic Review
Optical Properties of OPEs
Oligophenylene ethynylenes, known as OPEs, are a sequence of aromatic rings linked by triple bonds, the properties of which can be modulated by varying the length of the rigid main chain or/and the nature and position of the substituents on the aromatic units. They are luminescent molecules with high quantum yields and can be designed to enter a cell and act as antimicrobial and antiviral compounds, as biocompatible fluorescent probes directed towards target organelles in living cells, as labelling agents, as selective sensors for the detection of fibrillar and prefibrillar amyloid in the proteic field and in a fluorescence turn-on system for the detection of saccharides, as photosensitizers in photodynamic therapy (due to their capacity to highly induce toxicity after light activation), and as drug delivery systems.
  • 616
  • 08 Jun 2021
  • Page
  • of
  • 15
Featured Entry Collections
>>

Featured Books

>>
Encyclopedia of Social Sciences
Encyclopedia of COVID-19
Encyclopedia of Fungi
Encyclopedia of Digital Society, Industry 5.0 and Smart City
ScholarVision Creations
Feedback