Your browser does not fully support modern features. Please upgrade for a smoother experience.
Subject:
All Disciplines Arts & Humanities Biology & Life Sciences Business & Economics Chemistry & Materials Science Computer Science & Mathematics Engineering Environmental & Earth Sciences Medicine & Pharmacology Physical Sciences Public Health & Healthcare Social Sciences
Sort by:
Most Viewed Latest Alphabetical (A-Z) Alphabetical (Z-A)
Filter:
All Topic Review Biography Peer Reviewed Entry Video Entry
Topic Review
Synthesis of Sulfoxides and Sulfinamides from β-Sulfinyl Esters
Sulfoxides and sulfinamides play important roles in the pharmaceutical industry, organic synthesis and fine chemicals. Under catalysis by transition metals, β-sulfinyl esters, as nucleophilic reagents, react with a variety of electrophilic reagents to produce sulfoxides and sulfinamides. 
  • 1.1K
  • 06 May 2023
Topic Review
C-C and C-Heteroatom Bonds Construction
Acyl-containing organic compounds, including ketones, esters, amides, and so forth, are a huge library of widespread chemical feedstocks which play a vital role in countless fields such as pharmaceuticals, natural products, advanced materials, and fine chemicals.
  • 1.1K
  • 28 Dec 2022
Topic Review
Sweet Boron
Boron neutron capture therapy (BNCT) is a binary type of radiotherapy for the treatment of cancer. Due to recent developments of neutron accelerators and their installation in some hospitals, BNCT is on the rise worldwide and is expected to have a significant impact on patient treatments. Therefore, there is an increasing need for improved boron delivery agents. 
  • 1.1K
  • 03 Mar 2022
Topic Review
(−)-Methyl-Oleocanthal, a New Oleocanthal Metabolite
The antioxidant and anti-inflammatory responses of (−)-methyl-oleocanthal (met-OLE), a new metabolite of the extra virgin olive oil (EVOO) phenolic oleocanthal (OLE), were explored in lipopolysaccharide (LPS)-induced murine peritoneal macrophages. Possible signaling pathways and epigenetic modulation of histones were studied. Met-OLE inhibited LPS-induced intracellular reactive oxygen species (ROS) and nitrite (NO) production and decreased the overexpression of the pro-inflammatory enzymes COX-2, mPGES-1 and iNOS in murine macrophages.
  • 1.1K
  • 13 Jan 2022
Topic Review
Metal-Promoted Heterocyclization
The recent formulation, production, and ongoing administration of vaccines represent a starting point in the battle against SARS-CoV-2, but they cannot be the only aid available. In this regard, the use of drugs capable to mitigate and fight the virus is a crucial aspect of the pharmacological strategy. Among the plethora of approved drugs, a consistent element is a heterocyclic framework inside its skeleton. Heterocycles have played a pivotal role for decades in the pharmaceutical industry due to their high bioactivity derived from anticancer, antiviral, and anti-inflammatory capabilities. In this context, the development of new performing and sustainable synthetic strategies to obtain heterocyclic molecules has become a key focus of scientists.
  • 1.1K
  • 09 Jul 2021
Topic Review
Optical Properties of OPEs
Oligophenylene ethynylenes, known as OPEs, are a sequence of aromatic rings linked by triple bonds, the properties of which can be modulated by varying the length of the rigid main chain or/and the nature and position of the substituents on the aromatic units. They are luminescent molecules with high quantum yields and can be designed to enter a cell and act as antimicrobial and antiviral compounds, as biocompatible fluorescent probes directed towards target organelles in living cells, as labelling agents, as selective sensors for the detection of fibrillar and prefibrillar amyloid in the proteic field and in a fluorescence turn-on system for the detection of saccharides, as photosensitizers in photodynamic therapy (due to their capacity to highly induce toxicity after light activation), and as drug delivery systems.
  • 1.1K
  • 08 Jun 2021
Topic Review
Pillar[n]arene-Based Supramolecular Polymers
Supramolecular chemistry enables the manipulation of functional components on a molecular scale, facilitating a “bottom-up” approach to govern the sizes and structures of supramolecular materials. Using dynamic non-covalent interactions, supramolecular polymers can create materials with reversible and degradable characteristics and the abilities to self-heal and respond to external stimuli. Pillar[n]arene represents a novel class of macrocyclic hosts, emerging after cyclodextrins, crown ethers, calixarenes, and cucurbiturils. Its significance lies in its distinctive structure, comparing an electron-rich cavity and two finely adjustable rims, which has sparked considerable interest.
  • 1.1K
  • 21 Feb 2024
Topic Review
Macroalgae Specialized Metabolites with Anti-Inflammatory Activity
The seaweeds or macroalgae belong to the basic tropic level in the marine water ecosystem and are responsible, with microalgae, for the balance of the abiotic and biotic factors of marine life. Seaweeds represent a valuable resource of bioactive compounds associated with anti-inflammatory effects and offer great potential for the development of new anti-inflammatory drugs.
  • 1.0K
  • 05 Jan 2023
Topic Review
G-Quadruplex DNA Catalysts
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Modified oligonucleotides (ODNs) based on this sequence  were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess.
  • 1.0K
  • 10 Feb 2022
Topic Review
Bridging Ligand Containing Terpyridine (bpat)
Synthesis strategy of a terpyridine bridging ligand was explained.
  • 1.0K
  • 20 Feb 2021
Topic Review
Solar Photooxygenations for Chemical Manufacturing
Photooxygenation reactions involving singlet oxygen (1O2) are utilized industrially as a mild and sustainable access to oxygenated products. Due to the usage of organic dyes as photosensitizers, these transformations can be successfully conducted using natural sunlight. Modern solar chemical reactors enable outdoor operations on the demonstration (multigram) to technical (multikilogram) scales and have subsequently been employed for the manufacturing of fine chemicals such as fragrances or biologically active compounds. This review highlights examples of solarphotooxygenations for the manufacturing of industrially relevant target compounds and discusses current challenges and opportunities of this sustainable methodology.
  • 1.0K
  • 29 Mar 2021
Topic Review
1,2-cis glycosylation
Controlling the stereoselectivity of 1,2-cis glycosylation is one of the most challenging tasks in the chemical synthesis of glycans. There are various 1,2-cis glycosides in nature, such as α-glucoside and β-mannoside in glycoproteins, glycolipids, proteoglycans, microbial polysaccharides, and bioactive natural products. In the structure of polysaccharides such as α-glucan, 1,2-cis α-glucosides were found to be the major linkage between the glucopyranosides. Various regioisomeric linkages, 1→3, 1→4, and 1→6 for the backbone structure, and 1→2/3/4/6 for branching in the polysaccharide as well as in the oligosaccharides were identified. To achieve highly stereoselective 1,2-cis glycosylation, including α-glucosylation, a number of strategies using inter- and intra-molecular methodologies have been explored.
  • 1.0K
  • 09 Aug 2023
Topic Review
Mechanism of Removal of Heavy Metals by NF
Nanofiltration is a type of membrane filtration that employs a semi-permeable membrane. Unlike other types of membrane filtration systems, nanofiltration membranes have pore sizes of less than 10 nm.
  • 1.0K
  • 21 Sep 2023
Topic Review
Antimicrobial Metallopharmaceuticals with Tridentate Schiff Bases
The azomethine group is the common structural feature of SBs, where the substituents can be alkyl, cycloalkyl, aryl, or heterocyclic groups. The carbon atom of the C=Nimine bond is prone to nucleophilic addition, while the nitrogen atom possesses a highly reactive free electron pair that can form stable complexes with metal ions. SBs are among the most widely used organic compounds, showing a wide range of applications as intermediates in organic synthesis, chemosensors, and polymeric stabilizers, in the food, dye, and pigment industry, as well as as catalysts and, in recent years, for their recognized biological properties. The use of tridentate SBs ligands in different organometallic and coordination complexes containing main-group metals and transition metals has been an option to study the biological activity of new possible metallopharmaceuticals that contribute to increase activity and to counteract the effect of microbial resistance.
  • 1.0K
  • 21 Sep 2022
Topic Review
Carbon-Based Iron Catalysts for Organic Synthesis
Carbon-based iron catalysts combining the advantages of iron and carbon material are efficient and sustainable catalysts for green organic synthesis.
  • 1.0K
  • 01 Feb 2023
Topic Review
Teucrium Taxa Used in Kurdistan Region
Herbal medicine is still widely practiced in the Kurdistan Region, Iraq, especially by people living in villages in mountainous regions. Seven taxa belonging to the genus Teucrium (family Lamiaceae) are commonly employed in the Kurdish traditional medicine, especially to treat jaundice, stomachache and abdominal problems. Teucrium L. is the second-largest genus of the subfamily Ajugoideae in the family Lamiaceae (Labiatae), with a subcosmopolitan distribution and more than 430 taxa with accepted names. Mild climate regions, such as the Mediterranean and the Middle East areas, contain about 90% of the total Teucrium taxa. 
  • 997
  • 27 May 2022
Topic Review
The Asymmetric Hydroarylation of Activated Aryl Portions
Hydroarylation reactions enable the formation of new Csp2–Csp3 or Csp2–Csp2 bonds using aromatic substrates. Its outcome is described as the addition of hydrogen and an aryl group to an unsaturated moiety, resulting in the functionalization of the aromatic Csp2–H bond. Hydroarylation reactions can occur by a direct functionalization via insertion of an unsaturated compound or with the use of pre-activated aryl substrates, usually aryl-iodides or aryl-boronated. Below are reported some example from the scientific production of the last 10 years about the asymmetric hydroarylation of activated aryl portions. Nickel and palladium turned out to be the more-employed metals. 
  • 995
  • 07 Dec 2022
Topic Review
Marine Endoperoxide Norterpenes
Organic extracts of marine invertebrates, mainly sponges, from seas all over the world are well known for their high in vitro anticancer and antibiotic activities which make them promising sources of compounds with potential use as pharmaceutical leads. Most of the structures discovered so far have a peculiar structural feature in common: a 1,2-dioxane ring. This is a highly reactive heterocycle that can be considered as an endoperoxide function. Together with other structural features, this group could be responsible for the strong biological activities of the substances present in the extracts. Numerous research programs have focused on their structural elucidation and total synthesis since the seventies. As a consequence, the number of established chiral centres and the similarity between different naturally occurring substances is increasingly higher. Most of these compounds have a terpenoid nature, mainly diterpene and sesterterpene, with several peculiar structural features, such as the loss of one carbon atom. Although there are many reviews dealing with the occurrence of marine peroxides, their activities, or potential pharmaceutical uses, no one has focused on those having a terpene origin and the endoperoxide function. We present here a comprehensive review of these compounds paying special attention to their structural features and their biological activity.
  • 994
  • 15 Dec 2021
Topic Review
Biogenesis of Bispyrrolidinoindoline Epi(poly)thiodioxopiperazines
Within the 2,5-dioxopiperazine-containing natural products generated by “head-to-tail” cyclization of peptides, those derived from tryptophan allow further structural diversification due to the rich chemical reactivity of the indole heterocycle, which can generate tetracyclic fragments of hexahydropyrrolo[2,3-b]indole or pyrrolidinoindoline skeleton fused to the 2,5-dioxopiperazine. Even more complex are the dimeric bispyrrolidinoindoline epi(poly)thiodioxopiperazines (BPI-ETPs), since they feature transannular (poly)sulfide bridges connecting C3 and C6 of their 2,5-dioxopiperazine rings. Homo- and heterodimers composed of diastereomeric epi(poly)thiodioxopiperazines increase the complexity of the family.
  • 990
  • 18 Nov 2022
Biography
David W.C. MacMillan
David W.C. MacMillan is a Scottish-born American chemist renowned for his pioneering work in the field of asymmetric organocatalysis. Born in Bellshill, Scotland, in 1968, MacMillan earned his undergraduate degree from the University of Glasgow and completed his Ph.D. under Professor Larry Overman at the University of California, Irvine.[1] He began his independent academic career at the Univers
  • 986
  • 07 Apr 2025
  • Page
  • of
  • 16
Academic Video Service

Quick Survey

Encyclopedia MDPI is conducting a targeted survey to identify the specific barriers hindering efficient research. We invite you to spend 3 minutes defining the priorities for our next generation of structured knowledge tools.
Take Survey