Summary

Organic synthesis is the tool for the preparation of small molecules with interesting biological and medicinal properties—new compounds with activity against diseases affecting humankind today such as cancer, metabolic disorders, neurodegenerative disorders or infectious diseases, as well as new syntheses of known drugs. New bioactive compounds are designed and synthesized to target key metabolic reactions in pathological processes as the first steps toward drug discovery. The crosstalk between synthetic and medicinal chemists enable a high impact of new synthetic methodologies in drug discovery. The aim is to highlight the role that organic synthesis plays in developing methods that may be exploited for finding lead compounds and drugs by the pharmaceutical industry.

Expand All
Entries
Topic Review
Hybrid Organic–Inorganic Perovskite Halide Materials for Photovoltaics
Hybrid organic–inorganic perovskite (HOIP) photovoltaics have emerged as a promising new technology for the next generation of photovoltaics since their first development 10 years ago, and show a high-power conversion efficiency (PCE) of about 29.3%. The power-conversion efficiency of these perovskite photovoltaics depends on the base materials used in their development, and methylammonium lead iodide is generally used as the main component. Perovskite materials have been further explored to increase their efficiency, as they are cheaper and easier to fabricate than silicon photovoltaics, which will lead to better commercialization. Even with these advantages, perovskite photovoltaics have a few drawbacks, such as their stability when in contact with heat and humidity, which pales in comparison to the 25-year stability of silicon, even with improvements are made when exploring new materials. To expand the benefits and address the drawbacks of perovskite photovoltaics, perovskite–silicon tandem photovoltaics have been suggested as a solution in the commercialization of perovskite photovoltaics. This tandem photovoltaic results in an increased PCE value by presenting a better total absorption wavelength for both perovskite and silicon photovoltaics.
  • 970
  • 17 Mar 2022
Topic Review
Using CNSL for the Synthesis of Surfactants
Cashew Nut Shell Liquid (CNSL) is a promising non-edible renewable resource, directly extracted from the shell of the cashew nut. The interesting structure of CNSL and its components (cardanol, anacardic acid and cardol) lead to the synthesis of biobased surfactants. 
  • 3.0K
  • 10 Mar 2022
Topic Review
Sweet Boron
Boron neutron capture therapy (BNCT) is a binary type of radiotherapy for the treatment of cancer. Due to recent developments of neutron accelerators and their installation in some hospitals, BNCT is on the rise worldwide and is expected to have a significant impact on patient treatments. Therefore, there is an increasing need for improved boron delivery agents. 
  • 1.1K
  • 03 Mar 2022
Topic Review
Betulin
Betulin is an important triterpenoid substance isolated from birch bark, which, together with its sulfates, exhibits important bioactive properties. Using the potentiometric titration method, the product of acidity constants K1 and K2 of a solution of the betulin disulfate H+ form has been found to be 3.86 × 10–6 ± 0.004. It has been demonstrated by the thermal analysis that betulin and the betulin disulfate sodium salt are stable at temperatures of up to 240 and 220 °C, respectively. 
  • 1.8K
  • 28 Feb 2022
Topic Review
Clays and the Origin of Life
Clays are able to replicate and drive the evolution of metabolism; they have the catalytic ability to synthesize monomers (amino acids, nucleotides and so on) and polymerize them, resulting in RNA–peptide worlds in which RNA replicates (genes) and, in cooperation with coded peptides, drives the evolution of the cell. 
  • 6.3K
  • 25 Feb 2022
Topic Review
Metal Complexes of the Porphyrin-Functionalized Polybenzoxazine
Porphyrin is a molecular material with many potential applications. New porphyrin-functionalized benzoxazine (Por-BZ) in high purity and yield was synthesized in this study based on 1H and 13C NMR and FTIR spectroscopic analyses through the reduction of Schiff base formed from tetrakis(4-aminophenyl)porphyrin (TAPP) and salicylaldehyde and the subsequent reaction with CH2O. Thermal properties of the product formed through ring-opening polymerization (ROP) of Por-BZ were measured using DSC, TGA and FTIR spectroscopy. Because of the rigid structure of the porphyrin moiety appended to the benzoxazine unit, the temperature required for ROP (314 °C) was higher than the typical Pa-type benzoxazine monomer (ca. 260 °C); furthermore, poly(Por-BZ) possessed a high thermal decomposition temperature (Td10 = 478 °C) and char yield (66 wt%) after thermal polymerization at 240 °C. An investigation of the thermal and luminescence properties of metal–porphyrin complexes revealed that the insertion of Ni and Zn ions decreased the thermal ROP temperatures of the Por-BZ/Ni and Por-BZ/Zn complexes significantly, to 241 and 231 °C, respectively. The metal ions acted as the effective promoter and catalyst for the thermal polymerization of the Por-BZ monomer, and also improved the thermal stabilities after thermal polymerization. 
  • 1.6K
  • 24 Feb 2022
Topic Review
Gemini Surfactants
Gemini surfactants are dimeric structures, composed of two hydrophobic chains and two hydrophilic heads, linked by a spacer at or near the head groups. They present lower CMC, better efficiency to form micelles, and solubilization capacity comparedto their conventional (monomeric) counterparts. They can also reduce the surface tension of water and the oil–water interfacial tension from 10 to 100 times. This behaviour depends mainly on the nature of their components (heads, hydrophobic chains and spacer); thus, their synthesis is focused mainly on varying the type and length of these components.
  • 11.2K
  • 21 Feb 2022
Topic Review
Different Schiff Bases
Schiff bases are a vast group of compounds characterized by the presence of a double bond linking carbon and nitrogen atoms, the versatility of which is generated in the many ways to combine a variety of alkyl or aryl substituents.
  • 1.8K
  • 18 Feb 2022
Topic Review
Visible-Light Photoredox Catalysis for the Thiol-Ene/Yne Reactions
Visible-light photoredox catalysis has been established as a popular and powerful tool for organic transformations owing to its inherent characterization of environmental friendliness and sustainability in the past decades. The thiol-ene/yne reactions, the direct hydrothiolation of alkenes/alkynes with thiols, represents one of the most efficient and atom-economic approaches for the carbon-sulfur bonds construction. In traditional methodologies, harsh conditions such as stoichiometric reagents or a specialized UV photo-apparatus were necessary suffering from various disadvantages. In particular, visible-light photoredox catalysis has also been demonstrated to be a greener and milder protocol for the thiol-ene/yne reactions in recent years. Additionally, unprecedented advancements have been achieved in this area during the past decade.
  • 3.2K
  • 11 Feb 2022
Topic Review
G-Quadruplex DNA Catalysts
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Modified oligonucleotides (ODNs) based on this sequence  were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess.
  • 1.0K
  • 10 Feb 2022
  • Page
  • of
  • 18
>>