Summary

Organic synthesis is the tool for the preparation of small molecules with interesting biological and medicinal properties—new compounds with activity against diseases affecting humankind today such as cancer, metabolic disorders, neurodegenerative disorders or infectious diseases, as well as new syntheses of known drugs. New bioactive compounds are designed and synthesized to target key metabolic reactions in pathological processes as the first steps toward drug discovery. The crosstalk between synthetic and medicinal chemists enable a high impact of new synthetic methodologies in drug discovery. The aim is to highlight the role that organic synthesis plays in developing methods that may be exploited for finding lead compounds and drugs by the pharmaceutical industry.

Expand All
Entries
Topic Review
Sweet Boron
Boron neutron capture therapy (BNCT) is a binary type of radiotherapy for the treatment of cancer. Due to recent developments of neutron accelerators and their installation in some hospitals, BNCT is on the rise worldwide and is expected to have a significant impact on patient treatments. Therefore, there is an increasing need for improved boron delivery agents. 
  • 539
  • 03 Mar 2022
Topic Review
Betulin
Betulin is an important triterpenoid substance isolated from birch bark, which, together with its sulfates, exhibits important bioactive properties. Using the potentiometric titration method, the product of acidity constants K1 and K2 of a solution of the betulin disulfate H+ form has been found to be 3.86 × 10–6 ± 0.004. It has been demonstrated by the thermal analysis that betulin and the betulin disulfate sodium salt are stable at temperatures of up to 240 and 220 °C, respectively. 
  • 644
  • 28 Feb 2022
Topic Review
Clays and the Origin of Life
Clays are able to replicate and drive the evolution of metabolism; they have the catalytic ability to synthesize monomers (amino acids, nucleotides and so on) and polymerize them, resulting in RNA–peptide worlds in which RNA replicates (genes) and, in cooperation with coded peptides, drives the evolution of the cell. 
  • 2.1K
  • 25 Feb 2022
Topic Review
Metal Complexes of the Porphyrin-Functionalized Polybenzoxazine
Porphyrin is a molecular material with many potential applications. New porphyrin-functionalized benzoxazine (Por-BZ) in high purity and yield was synthesized in this study based on 1H and 13C NMR and FTIR spectroscopic analyses through the reduction of Schiff base formed from tetrakis(4-aminophenyl)porphyrin (TAPP) and salicylaldehyde and the subsequent reaction with CH2O. Thermal properties of the product formed through ring-opening polymerization (ROP) of Por-BZ were measured using DSC, TGA and FTIR spectroscopy. Because of the rigid structure of the porphyrin moiety appended to the benzoxazine unit, the temperature required for ROP (314 °C) was higher than the typical Pa-type benzoxazine monomer (ca. 260 °C); furthermore, poly(Por-BZ) possessed a high thermal decomposition temperature (Td10 = 478 °C) and char yield (66 wt%) after thermal polymerization at 240 °C. An investigation of the thermal and luminescence properties of metal–porphyrin complexes revealed that the insertion of Ni and Zn ions decreased the thermal ROP temperatures of the Por-BZ/Ni and Por-BZ/Zn complexes significantly, to 241 and 231 °C, respectively. The metal ions acted as the effective promoter and catalyst for the thermal polymerization of the Por-BZ monomer, and also improved the thermal stabilities after thermal polymerization. 
  • 757
  • 24 Feb 2022
Topic Review
Gemini Surfactants
Gemini surfactants are dimeric structures, composed of two hydrophobic chains and two hydrophilic heads, linked by a spacer at or near the head groups. They present lower CMC, better efficiency to form micelles, and solubilization capacity comparedto their conventional (monomeric) counterparts. They can also reduce the surface tension of water and the oil–water interfacial tension from 10 to 100 times. This behaviour depends mainly on the nature of their components (heads, hydrophobic chains and spacer); thus, their synthesis is focused mainly on varying the type and length of these components.
  • 5.8K
  • 21 Feb 2022
Topic Review
Different Schiff Bases
Schiff bases are a vast group of compounds characterized by the presence of a double bond linking carbon and nitrogen atoms, the versatility of which is generated in the many ways to combine a variety of alkyl or aryl substituents.
  • 853
  • 18 Feb 2022
Topic Review
Visible-Light Photoredox Catalysis for the Thiol-Ene/Yne Reactions
Visible-light photoredox catalysis has been established as a popular and powerful tool for organic transformations owing to its inherent characterization of environmental friendliness and sustainability in the past decades. The thiol-ene/yne reactions, the direct hydrothiolation of alkenes/alkynes with thiols, represents one of the most efficient and atom-economic approaches for the carbon-sulfur bonds construction. In traditional methodologies, harsh conditions such as stoichiometric reagents or a specialized UV photo-apparatus were necessary suffering from various disadvantages. In particular, visible-light photoredox catalysis has also been demonstrated to be a greener and milder protocol for the thiol-ene/yne reactions in recent years. Additionally, unprecedented advancements have been achieved in this area during the past decade.
  • 1.0K
  • 11 Feb 2022
Topic Review
G-Quadruplex DNA Catalysts
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Modified oligonucleotides (ODNs) based on this sequence  were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess.
  • 485
  • 10 Feb 2022
Topic Review
Acyclic Nucleic Acids with Phosphodiester Linkages
The pseudo-rotational flexibility of the ribonucleotide is considerably limited due to the anomeric effect, and RNA/RNA and RNA/DNA duplexes are generally more thermally stable than DNA/DNA duplexes. The rigidity of the cyclic scaffold has been considered important for the formation of thermally stable duplexes, and the unexpectedly high thermal stability of duplexes formed with the participation of LNA oligomers could serve as an excellent justification for this point of view. However, this generalization is not consistent with the behavior of Peptide Nucleic Acids (PNA), in which the heterocyclic bases are attached to a linear peptide-like backbone, since duplexes composed of RNA or DNA and PNA strands are far more stable than RNA/RNA and DNA/DNA ones. This phenomenon may be attributed to the absence of a negative charge in the backbone, such that the absence of repulsive interactions balances the entropic cost of proper spatial organization of the flexible PNA scaffolds. Nonetheless, the widely accepted importance of the cyclic sugar components for the stability of the duplexes could be questioned. There is another perspective that can be applied to the acyclic analogs of nucleic acids that is related to the origin of life. The synthetic efforts on acyclic analogs of nucleic acids and provides information on the most interesting features of selected classes of such compounds, are here described. The selection includes the following types of analogs: Flexible (FNA), Unlocked (UNA), Glycol (GNA), Butyl (BuNA), Threoninol (TNA) and Serinol Nucleic Acids (SNA). These classes of analogs are discussed in terms of their synthetic methods, the thermal stability of their homo- and hetero-duplexes and their applicability in biological and biochemical research and nanotechnology.
  • 659
  • 10 Feb 2022
Topic Review
Catalytic Synthesis of Glycerol Carbonate
Glycerol carbonate (GC) belongs to the family of organic carbonates that are regarded as very typical “green chemistry” products for their unique advantages in many fields, such as high boiling point solvents, pharmaceutical intermediates, and material intermediates.
  • 1.6K
  • 10 Feb 2022
  • Page
  • of
  • 18
>>