Subject:
All Disciplines Arts & Humanities Biology & Life Sciences Business & Economics Chemistry & Materials Science Computer Science & Mathematics Engineering Environmental & Earth Sciences Medicine & Pharmacology Physical Sciences Public Health & Healthcare Social Sciences
Sort:
Hottest Latest Alphabetical (A-Z) Alphabetical (Z-A)
Type:
All Topic Review Biography
Topic Review
PEDOT:PSS Layer and Perovskite Solar Cells
Poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) is the most successful conducting polymer, which has been widely used in displays, transistors, various sensors and photovoltaics (PVs). It has high optical  transparency in the visible light range and low-temperature processing condition, making it one of the most widely used polymer hole transport materials inverted perovskite solar cells (PSCs), because of its high optical transparency in the visible light range and low-temperature processing condition. However, the stability of PSCs based on pristine PEDOT:PSS is far from satisfactory, which is ascribed to the acidic and hygroscopic nature of PEDOT:PSS, and property differences between PEDOT:PSS and perovskite materials, such as conductivity, work function and surface morphology. 
  • 1.4K
  • 10 Feb 2022
Topic Review
CNT-Based Chemical Sensors
Carbon nanotubes (CNTs) combine high electrical conductivity with high surface area and chemical stability, which makes them very promising for chemical sensing. 
  • 1.2K
  • 10 Feb 2022
Topic Review
Corrosion Inhibition of Metal Surfaces Mediated by 1,2,3-Triazoles
Corrosion is generally viewed as the destructive consequence of chemical reaction between a metal or metal alloy and its environment that contains corrosive agents. Compared to inorganic corrosion inhibitors, the organic ones are less toxic, can be also used at low concentrations, and have a better film-forming ability. The adsorption properties of organic corrosion inhibitors are primarily linked to the presence of both π-electrons from aromatic rings and heteroatoms in the molecular structures. Indeed, organic compounds containing nitrogen, phosphorus, sulfur, and oxygen atoms have been extensively investigated as corrosion inhibitors of metals and their alloys in acidic environments. In this respect, triazole derivatives are the most used nitrogen-containing organic inhibitors, in particular the family of 1,2,3-triazoles prepared under click chemistry regime by the prolific copper-catalyzed azide cycloaddition reactions. 
  • 1.1K
  • 10 Feb 2022
Topic Review
Nanomedicine Applications in Lung Cancer Drug Resistance Management
Lung cancer (LC) is one of the leading causes of cancer occurrence and mortality worldwide. Treatment of patients with advanced and metastatic LC presents a significant challenge, as malignant cells use different mechanisms to resist chemotherapy. Drug resistance (DR) is a complex process that occurs due to a variety of genetic and acquired factors. Identifying the mechanisms underlying DR in LC patients and possible therapeutic alternatives for more efficient therapy is a central goal of LC research. Advances in nanotechnology resulted in the development of targeted and multifunctional nanoscale drug constructs. The possible modulation of the components of nanomedicine, their surface functionalization, and the encapsulation of various active therapeutics provide promising tools to bypass crucial biological barriers. These attributes enhance the delivery of multiple therapeutic agents directly to the tumor microenvironment (TME), resulting in reversal of LC resistance to anticancer treatment. 
  • 473
  • 10 Feb 2022
Topic Review
G-Quadruplex DNA Catalysts
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Modified oligonucleotides (ODNs) based on this sequence  were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess.
  • 546
  • 10 Feb 2022
Topic Review
Oxonium Derivatives of nido-Carborane
Recent decades have demonstrated a growing interest in the chemistry of 7,8-dicarba-nido-undecaborante anion (nido-carborane) due to the wide possibilities of its application from medicine to catalysis. One of the main approaches to the modification of nido-carborane cluster is the ring-opening reactions of its cyclic oxonium derivatives with various nucleophiles, which opens practically unlimited prospects for the incorporation of nido-carborane into various macro- and biomolecules.
  • 534
  • 10 Feb 2022
Topic Review
Polycaprolactone-Based Biocomposites
The developments within the topic of biomaterials has taken hold of researchers due to the mounting concern of current environmental pollution as well as scarcity resources. Amongst all compatible biomaterials, polycaprolactone (PCL) is deemed to be a great potential biomaterial, especially to the tissue engineering sector, due to its advantages, including its biocompatibility and low bioactivity exhibition. The commercialization of PCL is deemed as infant technology despite of all its advantages. This contributed to the disadvantages of PCL, including expensive, toxic, and complex.
  • 3.9K
  • 10 Feb 2022
Topic Review
Pseudomonas Lipopeptides
The Pseudomonas genus is ubiquitous and comprises species which are well known phytopathogens, such as P. syringae, or opportunistic human pathogens, such as P. aeruginosa, but also host members associated with water, soil and plant surfaces. Pseudomonas spp. are well adapted to growing in the rhizosphere and are well suited for biocontrol and growth promotion. Pseudomonas lipopeptides (Ps-LPs) play crucial roles in bacterial physiology, host–microbe interactions and plant disease control.
  • 524
  • 09 Feb 2022
Topic Review
Metal-Organic Frameworks-Based Sensors for Food Safety
Metal-organic frameworks (MOFs) are a class of crystalline porous materials systems structured by using metals linked together by organic bridging ligands.
  • 1.1K
  • 09 Feb 2022
Topic Review
Birch Plywood
Increasing demand pressures on the fibre supply are forcing manufacturers to explore using new species in plywood. Here authors investigated aspen and black alder, alone and in combination with birch faces, and with different veneer thicknesses in plywood production.
  • 3.1K
  • 09 Feb 2022
  • Page
  • of
  • 467
Featured Entry Collections
>>

Featured Books

>>
Encyclopedia of Social Sciences
Encyclopedia of COVID-19
Encyclopedia of Fungi
Encyclopedia of Digital Society, Industry 5.0 and Smart City
ScholarVision Creations
Feedback