Subject:
All Disciplines Arts & Humanities Biology & Life Sciences Business & Economics Chemistry & Materials Science Computer Science & Mathematics Engineering Environmental & Earth Sciences Medicine & Pharmacology Physical Sciences Public Health & Healthcare Social Sciences
Sort:
Hottest Latest Alphabetical (A-Z) Alphabetical (Z-A)
Type:
All Topic Review Biography
Topic Review
G-Quadruplex DNA Catalysts
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Modified oligonucleotides (ODNs) based on this sequence  were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess.
  • 549
  • 10 Feb 2022
Topic Review
g-C3N4 Photocatalysts
Graphitized carbon nitride (g-C3N4), as a metal-free, visible-light-responsive photocatalyst, has a very broad application prospect in the fields of solar energy conversion and environmental remediation. The g-C3N4 photocatalyst owns a series of conspicuous characteristics, such as very suitable band structure, strong physicochemical stability, abundant reserves, low cost, etc. Research on the g-C3N4 or g-C3N4-based photocatalysts for real applications has become a competitive hot topic and a frontier area with thousands of publications over the past 17 years. 
  • 343
  • 31 Jan 2024
Topic Review
Fused 1,5-naphthyridines
Heterocyclic nitrogen compounds, including fused 1,5-naphthyridines, have versatile applications in synthetic organic chemistry and play an important role in the field of medicinal chemistry, as many of them have a wide range of biological activities. In this review, a wide range of synthetic protocols for the construction of this scaffold are presented. For example, Friedländer, Skraup, Semmlere-Wolff, and hetero-Diels-Alder, among others, are well known classical synthetic protocols used for the construction of the main 1,5-naphthyridine scaffold. These syntheses are classified according to the nature of the cycle fused to the 1,5-naphthyridine ring: carbocycles, nitrogen heterocycles, oxygen heterocycles, and sulphur heterocycles. In addition, taking into account the aforementioned versatility of these heterocycles, their reactivity is presented as well as their use as a ligand for metal complexes formation. Finally, those fused 1,5-naphthyridines that present biological activity and optical applications, among others, are indicated.
  • 1.2K
  • 31 Aug 2020
Topic Review
Furfuryl Alcohol
Furfuryl alcohol (FuOH, C4H3OCH2OH, 2-furylmethanol, 2-furancarbinol) has applications in the fabrication of foundry resins, the ingredient production of P-series fuels, in liquid alkanes and in food production. It is also a very important intermediate in fine chemical synthesis and the polymer industry, and it is used as a chemical intermediate for the synthesis of lysine, vitamin C and levulinic acid and employed as a lubricant and as a dispersing agent.
  • 2.2K
  • 10 Oct 2020
Topic Review
Furane-Based Photoinitiators of Polymerization
Photopolymerization is an active research field enabling to polymerize in greener conditions than that performed with traditional thermal polymerization. A great deal of effort is devoted to developing visible light photoinitiating systems. Indeed, the traditional UV (Ultra Violet) photoinitiating systems are currently the focus of numerous safety concerns so alternatives to UV light are being actively researched. However, visible light photons are less energetic than UV photons so the reactivity of the photoinitiating systems should be improved to address this issue. In this field, furane constitutes an interesting candidate for the design of photocatalysts of polymerization due to its low cost and its easy chemical modification.
  • 429
  • 09 Mar 2023
Topic Review
Fungi-Mediated Synthesis of Nanoparticles
Fungi are very promising biological objects for the green synthesis of nanoparticles. Biogenic synthesis of nanoparticles using different mycological cultures and substances obtained from them is a promising, easy and environmentally friendly method. By varying the synthesis conditions, the same culture can be used to produce nanoparticles with different sizes, shapes, stability in colloids and, therefore, different biological activity. Fungi are capable of producing a wide range of biologically active compounds and have a powerful enzymatic system that allows them to form nanoparticles of various chemical elements.
  • 489
  • 12 Jan 2023
Topic Review
Fungal Degradation of Wood
Wood durability researchers have long described fungal decay of timber using the starkly simple terms of white, brown and soft rot, along with the less destructive mold and stain fungi. These terms have taken on an almost iconic meaning but are only based upon the outward appearance of the damaged timber. Long-term deterioration studies, as well as the emerging genetic tools, are showing the fallacy of simplifying the decay process into such broad groups.
  • 2.0K
  • 17 Dec 2020
Topic Review
Fundaments of Electron Transfer in D-B-A Supramolecular Systems
If we were to sort chemical reactions by their importance for life, electron transfer (ET) would be the best candidate to be ranked first. The reasons for its importance lie in the key role it carries out in major biological processes, such as the electron transport chain and photosynthesis, as well as artificial processes, such as information storage (i.e., photography) and energy conversion (batteries). It is worth noting that ET is ubiquitous in all the branches of chemistry, from organic and biochemistry to physical and inorganic chemistry. The systematic study of the ET processes can be fundamental both for basic knowledge and for strongly applicative reasons.
  • 547
  • 01 Jun 2022
Topic Review
Fundamentals of Water-Splitting Reaction
A viable energy source, hydrogen has the advantages of clean energy, high conversion efficiency, and environmental friendliness. One of the possible routes for the generation of hydrogen in this context is the solar water splitting reaction under direct sunlight. To succeed on a commercial basis, though, there remains a very long way to go. 
  • 1.3K
  • 07 Nov 2022
Topic Review
Fundamentals of the Electroreduction of CO2
Carbon dioxide (CO2) is one of the main greenhouse gases and the major factor driving global climate change. From the viewpoint of abundance, economics, non-toxicity, and renewability, CO2 is an ideal and significant C1 resource, and its capture and recycling into fuels and chemical feedstocks using renewable energy is of great significance for the sustainable development of society. Electrochemical CO2 reduction reactions (CO2RRs) are an important pathway to utilize CO2 resources. Zinc has been demonstrated as an effective catalyst for CO2RRs.
  • 1.2K
  • 17 Apr 2023
  • Page
  • of
  • 467
Featured Entry Collections
>>

Featured Books

>>
Encyclopedia of Social Sciences
Encyclopedia of COVID-19
Encyclopedia of Fungi
Encyclopedia of Digital Society, Industry 5.0 and Smart City
ScholarVision Creations
Feedback