Subject:
All Disciplines Arts & Humanities Biology & Life Sciences Business & Economics Chemistry & Materials Science Computer Science & Mathematics Engineering Environmental & Earth Sciences Medicine & Pharmacology Physical Sciences Public Health & Healthcare Social Sciences
Sort:
Hottest Latest Alphabetical (A-Z) Alphabetical (Z-A)
Type:
All Topic Review Biography
Topic Review
Isolated Marine Compounds with Antifungal Activity
The oceans represent the largest ecosystem on earth, with a high diversity of organisms. Oceans have received some attention, and promising compounds with antimicrobial activities were isolated from marine organisms such as bacteria, fungi, algae, sea cucumbers, sea sponges, etc. 
  • 551
  • 02 Aug 2023
Topic Review
Taccalonolides
Taccalonolides are a new class of microtube-stabilizing agents isolated from plants of the genus Tacca demonstrating effectiveness against drug-resistant tumors in cellular and animal models.
  • 550
  • 16 Sep 2021
Topic Review
Biodegradable Microparticles for Regenerative Medicine
Regenerative medicine is one of the most attractive topics of research worldwide. Different strategies are proposed, and a range of materials of various forms and compositions tailored for tissue engineering are developed, but this approach just started to emerge in clinics. Biodegradable microparticles (MPs) made from degradable and biocompatible polymers, with a mean diameter of ~200 μm, are attractive not only as 3D matrices to multiply cells but also as a scaffold to support tissue rebuilding.
  • 550
  • 19 Apr 2022
Topic Review
Influenza Antiviral Drugs
Influenza virus is a highly contagious zoonotic respiratory disease that causes seasonal outbreaks each year and unpredictable pandemics occasionally with high morbidity and mortality rates, posing a great threat to public health worldwide. Besides the limited effect of vaccines, the prob-lem is exacerbated by the lack of drugs with strong antiviral activity against all flu strains. Cur-rently, there are two classes of antiviral drugs available that are chemosynthetic and approved against influenza A virus for prophylactic and therapeutic treatment, but the appearance of drug-resistant virus strains is a serious issue that strikes at the core of influenza control. There is therefore an urgent need to develop new antiviral drugs. Many reports have shown that the de-velopment of novel bioactive plant extracts and microbial extracts has significant advantages in influenza treatment.
  • 549
  • 01 Mar 2021
Topic Review
Towards the Commercialization of Solid Oxide Fuel Cells
The solid oxide fuel cell (SOFC) has become a promising energy conversion technology due to its high efficiency and low environmental impact. Though there are several reviews on SOFCs, comprehensive reports that simultaneously combine the latest developments in materials and integration strategies are very limited. This paper addresses those issues and discusses SOFCs working principles, design types, the fuels used, and the required features for electrodes and electrolytes.
  • 549
  • 21 Dec 2021
Topic Review
Raman Spectroscopy in Biosensing
The effect of Raman scattering is a result of inelastic light scattering processes, which lead to the emission of scattered light with a different frequency associated with molecular vibrations of the identified molecule. Spontaneous Raman scattering is usually weak, resulting in complexities with the separation of weak inelastically scattered light and intense Rayleigh scattering. These limitations have led to the development of various techniques for enhancing Raman scattering, including resonance Raman spectroscopy (RRS) and nonlinear Raman spectroscopy (coherent anti-Stokes Raman spectroscopy and stimulated Raman spectroscopy). Furthermore, the discovery of the phenomenon of enhanced Raman scattering near metallic nanostructures gave impetus to the development of the surface-enhanced Raman spectroscopy (SERS) as well as its combination with resonance Raman spectroscopy and nonlinear Raman spectroscopic techniques. The combination of nonlinear and resonant optical effects with metal substrates or nanoparticles can be used to increase speed, spatial resolution, and signal amplification in Raman spectroscopy, making these techniques promising for the analysis and characterization of biological samples.
  • 549
  • 07 Jan 2022
Topic Review
G-Quadruplex DNA Catalysts
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Modified oligonucleotides (ODNs) based on this sequence  were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess.
  • 549
  • 10 Feb 2022
Topic Review
Sodiophilicity Regulation in Metallic Na Anodes
The Na metal anode is the essential component for room-temperature sodium-metal batteries (SMBs), such as Na-S, Na-Se, and Na-O2. However, the practical application of liquid-electrolyte-based SMBs has been troubled by extensive volume change and mossy/dendritic growth during Na electrodeposition. In this regard, the sodiophilicity (of the solid electrolytes or 2D/3D Na hosts) has been widely deemed vital for achieving stable Na metal anodes in either solid- or liquid-electrolyte-based SMBs, and many strategies have emerged to improve Na wettability and stabilize Na metal anodes for the three types of batteries.
  • 549
  • 11 Jul 2022
Topic Review
Chitosan-Based Agronanochemicals
Chitosan is established as a non-toxic, biodegradable, and biocompatible compound. It offers fascinating properties; antimicrobial, antiviral, antifungal, antioxidant, anti-inflammatory, bio-adhesion, adsorption enhancer, etc. Chitosan coupled with nanotechnology could offer a sustainable alternative to the use of conventional agrochemicals towards a safer agriculture industry.
  • 549
  • 19 Jul 2022
Topic Review
Biomedical Application of Silk-Based Cryogels
There is a need to develop the next generation of medical products that require biomaterials with improved properties. The versatility of various gels has pushed them to the forefront of biomaterials research. Cryogels, a type of gel scaffold made by controlled crosslinking under subzero or freezing temperatures, have great potential to address many current challenges. Unlike their hydrogel counterparts, which are also able to hold large amounts of biologically relevant fluids such as water, cryogels are often characterized by highly dense and crosslinked polymer walls, macroporous structures, and often improved properties. 
  • 549
  • 04 Jan 2023
  • Page
  • of
  • 467
Featured Entry Collections
>>

Featured Books

>>
Encyclopedia of Social Sciences
Encyclopedia of COVID-19
Encyclopedia of Fungi
Encyclopedia of Digital Society, Industry 5.0 and Smart City
ScholarVision Creations
Feedback