2. Milk Yield and Composition Association with Potential Combinations of αS1- and αS2-Casein Loci Haplotypic Sequences
Table 1 shows results of Bayesian inference of ANOVA to detect significant difference in average milk yield, protein, fat, dry matter, lactose, and somatic cell counts and curve shape parameters for milk yield and each of the aforementioned components across casein complex haplotypes. Statistically significant (p < 0.05) differences were found for milk yield and all components, but among the curve shape parameters (peaks and persistence), only average protein percentage peak reported significant differences across casein complex haplotypes. When the haplotypic sequence found at the αS1-casein locus is considered, four different haplotypic groups can be determined. A map of the linkage disequilibrium relationships across casein complex loci is shown in Figure 1.
Figure 1. Linkage disequilibrium map across casein complex loci (CSN1S1, locus for αS1-casein; CSN1S2, locus for αS2-casein; CSN2 locus for β-casein; and CSN3, locus for κ-casein). Accessed from Pizarro Inostroza et al.
[5].
Table 1. Bayesian inference for one-way ANOVA to determine the differences in the mean for milk yield and components and curve parameters through best fitting models across casein haplotypes in Murciano-Granadina goats.
| Trait |
Parameter |
Groups |
Sum of Squares |
df |
Mean Square |
F |
Sig. |
Bayes Factor |
| Milk Yield |
Peak |
Between |
69,689.375 |
86.000 |
810.342 |
0.545 |
0.958 |
0.000 |
| Within |
22,301.205 |
15.000 |
1486.747 |
|
|
|
| Persitence (b1) |
Between |
1.822 |
86.000 |
0.021 |
0.608 |
0.921 |
0.000 |
| Within |
0.523 |
15.000 |
0.035 |
|
|
|
| Persitence (b2) |
Between |
0.000 |
86.000 |
0.000 |
|
|
0.000 |
| Within |
0.000 |
15.000 |
0.000 |
|
|
|
| Kg |
Between |
18,562.178 |
86.000 |
215.839 |
17.316 |
0.001 |
120,000,000 |
| Within |
37,643.494 |
3020.000 |
12.465 |
|
|
|
| Fat |
Peak |
Between |
177,982.014 |
86.000 |
2069.558 |
0.818 |
0.729 |
0.000 |
| Within |
37,941.157 |
15.000 |
2529.410 |
|
|
|
| Persitence (b1) |
Between |
5.985 |
86.000 |
0.070 |
1.208 |
0.355 |
0.000 |
| Within |
0.864 |
15.000 |
0.058 |
|
|
|
| Persitence (b2) |
Between |
0.000 |
86.000 |
0.000 |
0.998 |
0.539 |
0.000 |
| Within |
0.000 |
15.000 |
0.000 |
|
|
|
| % |
Between |
1024.046 |
86.000 |
11.908 |
11.52 |
0.001 |
178,000,000 |
| Within |
3120.806 |
3020.000 |
1.033 |
|
|
|
| Protein |
Peak |
Between |
11,785.747 |
86.000 |
137.044 |
3.142 |
0.008 |
0.001 |
| Within |
654.156 |
15.000 |
43.610 |
|
|
|
| Persitence (b1) |
Between |
0.490 |
86.000 |
0.006 |
1.630 |
0.144 |
0.000 |
| Within |
0.052 |
15.000 |
0.003 |
|
|
|
| Persitence (b2) |
Between |
0.000 |
86.000 |
0.000 |
|
|
0.000 |
| Within |
0.000 |
15.000 |
0.000 |
|
|
|
| % |
Between |
253.694 |
86.000 |
2.950 |
16.951 |
0.001 |
311,000,000 |
| Within |
525.565 |
3020.000 |
0.174 |
|
|
|
| Dry Matter |
Peak |
Between |
243,045.970 |
86.000 |
2826.12 |
1.089 |
0.452 |
0.000 |
| Within |
38,915.155 |
15.000 |
2594.34 |
|
|
|
| Persitence (b1) |
Between |
8.013 |
86.000 |
0.093 |
1.330 |
0.274 |
0.000 |
| Within |
1.051 |
15.000 |
0.070 |
|
|
|
| Persitence (b2) |
Between |
0.000 |
86.000 |
0.000 |
0.661 |
0.882 |
0.000 |
| Within |
0.000 |
15.000 |
0.000 |
|
|
|
| % |
Between |
1823.530 |
86.000 |
21.204 |
13.804 |
0.001 |
382,000,000 |
| Within |
4638.983 |
3020.000 |
1.536 |
|
|
|
| Lactose |
Peak |
Between |
3683.784 |
86.000 |
42.835 |
1.238 |
0.334 |
0.000 |
| Within |
518.983 |
15.000 |
34.599 |
|
|
|
| Persitence (b1) |
Between |
0.164 |
86.000 |
0.002 |
0.906 |
0.634 |
0.000 |
| Within |
0.032 |
15.000 |
0.002 |
|
|
|
| Persitence (b2) |
Between |
0.000 |
86.000 |
0.000 |
|
|
0.000 |
| Within |
0.000 |
15.000 |
0.000 |
|
|
|
| % |
Between |
90.587 |
86.000 |
1.053 |
14.50 |
0.001 |
78,800,000 |
| Within |
219.336 |
3020.000 |
0.073 |
|
|
|
| Somatic cell counts |
Peak |
Between |
201,479,119.002 |
86.000 |
2,342,780.45 |
0.374 |
0.998 |
0.000 |
| Within |
93,871,863.089 |
15.000 |
6,258,124.21 |
|
|
|
| Persitence (b1) |
Between |
9,286,148,083,739 |
86.000 |
107,978,466 |
0.569 |
0.945 |
0.000 |
| Within |
2,847,041,628,535 |
15.000 |
189,802,775 |
|
|
|
| ×103 sc/mL |
Between |
1,735,786,503.91 |
86.000 |
20,183,564 |
22.388 |
0.001 |
457,000,000 |
| Within |
2,722,657,222.52 |
3020.000 |
901,542.13 |
|
|
|
First, a significantly higher average milk yield of 3.38 kg was found for haplotypes presenting the sequence AAGGAATTAAAAGGCCAA at the αS1-casein locus, when compared to those presenting GAGAAATCGAGAAAGCAA (2.61 kg), GAGAAATCGAGAGAGCGA (2.06 kg), and GAGGAATTAAAAGAGCAA (2.41 kg). The respective average fat percentage found for such sequences was 5.51%, 5.41%, 5.44%, and 5.16%. The average protein percentage for the same respective sequences was 3.56%, 3.53%, 3.46%, and 3.44%. The average dry matter percentage for the same sequences was 14.70%, 14.68%, 14.55%, and 14.19%, respectively. Lactose described the same trend, with the average lactose percentages being 4.97%, 4.84%, 4.83%, and 4.79%, respectively. Somatic cells counts were respectively 513.80 × 103, 1012.63 × 103, 1130.56 × 103, and 1139.81 × 103 sc/mL. These sequences differed in the bases in positions 1, 4, 15, and 16 within the allelic sequence, which correspond to alleles A→G, G→A, C→G, and C→G in SNPs 19, 26, 28, and 29, respectively (→ indicates the changes in allelic sequences).
Second, for those alleles that presented the common sequence of GAGGAATTAAAAGAGCAA for αS1-casein, the highest average milk yield (2.86 kg) was reported when the αs2-casein locus carried the haplotypic sequence TCGCGGCCAAGACCGAGG, followed by those carrying the sequence TCGCGATCGAGACCGAGC (2.68 kg) and CCGGGGCCAAGGCCAAGG (1.88 kg). The average protein percentage for these sequences was 3.65%, 3.56%, and 3.51%, respectively, while the average percentage of dry matter for the same sequences was 14.72%, 14.52%, and 14.30%. The average lactose percentages found were respectively 4.90%, 4.79%, and 4.78%. These sequences differed in the bases in positions 1, 4, 13, and 15, within the allelic sequence, which correspond to alleles T→C, C→G, A→G, and G→A in SNPs 2, 3, 10, and 12, respectively (→ indicates the changes in allelic sequences). Milk yield decreased by almost around 1 kg when any of the alleles changed to G or A.
Third, for the haplotypes carrying the GAGAAATCGAGAGAGCGA sequence at the αS1-casein locus, milk yield differed depending on the sequence present in αS2-casein. Haplotypes presenting the TCGCGGCCAAGGCCAAGG sequence at the αS2-casein locus reported an average milk yield of 2.40 kg and progressively decreased when the sequence changed to TTCCGATCGAGACCGACC (2.39 kg), TTCCAATTGGGACCGGCC (1.89 kg), or TTCCGATCGAGACCGGCC (1.47 kg). The results for fat reported the inverse situation, with the aforementioned sequences being associated with average percentages of 5.07%, 5.14%, 5.64%, and 5.88%, respectively, while for average protein percentages, these were 3.99%, 3.57%, 3.53%, and 3.42%, respectively. Average dry matter percentages were respectively 15.43%, 14.83%, 14.25%, and 14.17%. Lactose average percentages were TTCCGATCGAGACCGACC (4.97%), TTCCGATCGAGACCGGCC (4.83%), TTCCAATTGGGACCGGCC (4.79%), and TCGCGGCCAAGGCCAAGG (4.75%), respectively. Somatic cell counts for the same sequences were as follows TTCCGGCCAAGACCGAGG (456.83 × 103 sc/mL), TCGCGGCCAAGGCCAAGG (506.16 × 103 sc/mL), CCGGGGCCAAGGCCAAGG (847.15 × 103 sc/mL), and TTCCGATCGAGACCGGCC (1860.49 × 103 sc/mL). The progressively higher milk yields occurred when C, G, G, C, A, G, and A were present in SNPs 2, 3, 4, 5, 6, 10, and 12 and the GG polymorphism at SNP 17.
Fourth, when the haplotypic sequence GAGGAATTAAAAGAGCAA at the αS1-casein locus was followed by the sequence TTCCGGCCAAGACCGAGG (3.40 kg) of the αS2-casein locus, a significantly higher milk yield was found when compared to other sequences TTCCGATCGAGACCGGCC (1.64 kg), TCGCGGCCAAGGCCAAGG (2.17 kg), and CCGGGGCCAAGGCCAAGG (2.43 kg), respectively. The average fat percentage for the aforementioned sequences was 5.51%, 5.42%, 5.36%, and 5.29, respectively, with the sequence reporting the lowest average percentage of fat simultaneously being the one reporting the highest milk yield as well (TTCCGGCCAAGACCGAGG). This pattern repeated for the average protein and dry matter percentages as follows: 3.18% protein/14.38% dry matter (TTCCGGCCAAGACCGAGG), 3.42% protein/13.97% dry matter (CCGCGGCCAAGGCCAAGG), 3.45% protein/14.19% dry matter/4.77% lactose/940.29 × 103 sc/mL (CCGGGGCCAAGGCCAAGG), 3.57% protein/13.93% dry matter/1278.90 × 103 sc/mL (TCGCGGCCAAGACCGAGG), 3.63% protein/14.38% dry matter/917.33 × 103 sc/mL (TTCCGATCGAGACCGGCC), and 3.67% protein/14.57% dry matter/4.79% lactose/1981.14 × 103 sc/mL (TCGCGGCCAAGGCCAAGG). The sequences differed as some presented the alleles C, G, G, C, A, G, A, and G at SNPs 2, 3, 4, 5, 6, 10, 12, and 17, respectively.
3. Milk Yield and Composition Association with Potential Combinations of αS1- and β-Casein Loci Haplotypic Sequences
When the αS1-casein sequence GAGAAATCGAGAAAGCAA was associated to the sequence GGGATCTC of the β-casein locus, a higher milk yield was reported (2.45 kg) in comparison to the sequence GGGACCCC (2.34 kg). For these sequences, the percentage of fat reported was as follows: GGGACCCC (5.48%), GGAACCCC (5.45%), and GGGATCTC (5.29%) while the average percentages of protein were GGGACCCC (3.61%), GGAACCCC (3.56%), and GGGATCTC (3.78%). Average dry matter percentages were GGAACCCC (14.85%), GGGATCTC (14.46%), and GGGACCCC (14.77%), respectively. The sequence GGGACCCC presented an average lactose percentage of 4.88%, contrasting the slightly lower percentage of 4.80% reported for GGGATCTC, while the somatic cell counts were GGGACCCC (760.15 × 103 sc/mL) and GGGATCTC (645.96 × 103 sc/mL). Similarly, when the αS1-casein sequence GAGAAATCGAGAGAGCGA was associated with the β-casein locus sequence GGGATCTC (2.63 kg), there was an increase in milk yield, which, however, reduced the average fat/protein/dry matter percentages when followed by the β-casein locus sequence GGGGCCCC (2.03 kg), which parallelly decreased with the increase in milk yield as follows: GGGATCTC (4.91% fat/3.50% protein/13.95% dry matter/4.86% lactose/1148.89 × 103 sc/mL), GGGGCCCC (5.56% fat/3.97% protein/15.19% dry matter/4.59% lactose/959.09 × 103 sc/mL), and GGAATCTC (5.82% fat/3.63% protein/15.13% dry matter), respectively. The last combination corresponds to the combination of the αS1-casein sequence GAGGAATTAAAAGAGCAA with the β-casein sequences GGGGCCCC for which the milk yield reported was 2.96 kg, GGGACCCC (3.73 kg), GGGATCTC (2.90 kg), and GAGACCCC (3.31 kg). A negative correlation was found between milk yields and fat/protein/dry matter percentages, which parallelly decreased with the increase in milk yield as follows: GGGATCTC (6.21% fat/3.43% protein/14.90% dry matter), GGGACCCC (5.02% fat/3.35% protein/14.02% dry matter/744.33 × 103 sc/mL), GGGGCCCC (5.44 % fat/3.50% protein/13.96% dry matter/1255.74 × 103 sc/mL), and GAGACCCC (5.13% fat/3.52% protein/14.25% dry matter/788.10 × 103 sc/mL), respectively. The sequence GGAATCTC was associated with an increased average lactose percentage of 4.88% in comparison to the rest. The aforementioned sequences differed in the change of the alleles A→G, A→G, T→C and T→C at SNPs 34, 35, 36, and 37.
4. Milk Yield and Composition Association with Potential Combinations of αS1- and κ-Casein Loci Haplotypic Sequences
A wide variability was found in regards to the clusters of sequences for αS1-casein that were combined with those of κ-casein. Still, when the cluster characterized by the αS1-casein sequence GAGAAATCGAGAAAGCAA was combined with the κ-casein sequence TTCCCCAA.-.-GGTTCC (2.85 kg), milk yield increased significantly. The later sequence presented the alleles C, C, A, .-, G, and T, in contrast to the others, which presented T, T, T, AATC, A, and G at SNPs 39, 40, 41, 42, 43, and 44, respectively. Other haplotypes described the same variability. For instance, for the haplotypes clustered together considering the αS1-casein sequence GAGAAATCGAGAGAGCGA, it was not possible to define a clear trend in the association with milk yield, although statistically significant differences were found. As for the rest of the haplotypic sequences found in other loci of the casein complex, for κ-casein haplotypic sequences TTTTTTTTAATCAATCAAGGCC (6.07% fat/3.87% protein), TGCCTCAA.-.-GGTGTC (5.55% fat/3.33% protein), TTTCTCTA.-AATCGATGCC (5.33% fat/3.60% protein), and TTCCCCAA.-.-GGTTCC (5.12% fat/3.13% protein), the same negative correlation between average milk yield and fat/protein percentage was found.
In this widely variable context, when the sequence for the αS1-casein GAGGAATTAAAAGAGCAA was associated with the κ-casein sequence TTTCTCTA.-AATCGATGCC, milk yield slightly increased (2.49 kg) in comparison to when it was associated with the sequence TGTCTTTA.-AATCGAGGTC (2.20 kg). The sequences differed in regards to the presence of the alleles T, C, and C for SNPs 38, 40, and 44. Parallelly, the κ-casein sequences TTCCCCAA.-.- GGTTCC were associated with average fat contents of 5.39%, TTTCTCTA.-AATCGATGCC (4.91%), and TGTCTTTA.-AATCGAGGTC (5.08%), respectively, when the configuring alleles were instead G, T, and T for SNPs 38, 40, and 44. The great variability found in the case of average protein and dry matter percentages does not allow identification of association trends across haplotypes when κ-casein sequences are considered. Although a wide variability was also found for the average lactose percentage, the κ-casein sequence TTCCCCAA.-.-GGTTCC was associated with a slightly higher average percentage of lactose (4.87%) than that reported for the sequence TTTCTCTA.-AATCGATGCC (4.68%). The two sequences differed in regards to the presence of the alleles C, C A, .-, A, and T at SNPs 39, 40, 41, and 42. The same situation was found for the somatic cell counts, where a decreasing trend in a widely variably context was found. For instance, for the sequence TTCCCCAA.-.-GGTTCC, the somatic cell counts were 519.03 × 103 sc/mL; for TTTTTTTTAATCAATCAAGGCC, they were 1080.97 × 103 sc/mL; and for TTTCTCTA.-AATCGATGCC, they were 2025.01 × 103 sc/mL. Structural differences were found based on the presence of alleles C, C, A, .-, G, and T at SNPs 39, 40, 41, 42, 43, and 44.