Your browser does not fully support modern features. Please upgrade for a smoother experience.
Submitted Successfully!
Thank you for your contribution! You can also upload a video entry or images related to this topic. For video creation, please contact our Academic Video Service.
Version Summary Created by Modification Content Size Created at Operation
1 Vanessa Soto-Cerrato + 3731 word(s) 3731 2021-08-17 05:00:08 |
2 format correct Vivi Li Meta information modification 3731 2021-09-08 08:32:13 | |
3 move out from EC Conner Chen Meta information modification 3731 2021-09-22 03:09:39 |

Video Upload Options

We provide professional Academic Video Service to translate complex research into visually appealing presentations. Would you like to try it?
Cite
If you have any further questions, please contact Encyclopedia Editorial Office.
Soto-Cerrato, V. Targeting Autophagy for Cancer Treatment. Encyclopedia. Available online: https://encyclopedia.pub/entry/13974 (accessed on 02 May 2026).
Soto-Cerrato V. Targeting Autophagy for Cancer Treatment. Encyclopedia. Available at: https://encyclopedia.pub/entry/13974. Accessed May 02, 2026.
Soto-Cerrato, Vanessa. "Targeting Autophagy for Cancer Treatment" Encyclopedia, https://encyclopedia.pub/entry/13974 (accessed May 02, 2026).
Soto-Cerrato, V. (2021, September 07). Targeting Autophagy for Cancer Treatment. In Encyclopedia. https://encyclopedia.pub/entry/13974
Soto-Cerrato, Vanessa. "Targeting Autophagy for Cancer Treatment." Encyclopedia. Web. 07 September, 2021.
Targeting Autophagy for Cancer Treatment
Edit

Autophagy is a tightly regulated catabolic process that facilitates nutrient recycling from damaged organelles and other cellular components through lysosomal degradation. Deregulation of this process has been associated with the development of several pathophysiological processes, such as cancer and neurodegenerative diseases. In cancer, autophagy has opposing roles, being either cytoprotective or cytotoxic. Thus, deciphering the role of autophagy in each tumor context is crucial. Moreover, autophagy has been shown to contribute to chemoresistance in some patients. In this regard, autophagy modulation has recently emerged as a promising therapeutic strategy for the treatment and chemosensitization of tumors, and has already demonstrated positive clinical results in patients.

autophagy anticancer therapy autophagy inhibitors autophagic cell death chemoresistance chemosensitization

1. Introduction

Cellular homeostasis is crucial for cell survival and refers to all processes involved in the maintenance of an internal steady state at the level of the cell. Autophagy is one of the main catabolic mechanisms that contributes to cellular homeostasis, through the degradation and recycling of cytoplasmic components and organelles in the lysosomes [1][2]. This process confers the ability to adapt to environmental stresses, preventing cellular damage, and promoting cell survival, even in starving conditions, thus having a main physiologic cytoprotective role. It is a process tightly regulated and its dysfunction has been related to several pathologies, such as neurodegeneration, cancer, or aging [3]. Hence, autophagy modulation is emerging as a promising new therapeutic strategy to treat these malignancies [4]. Indeed, more than 120 clinical trials related to the process of autophagy were initiated to date. The majority of those target autophagy for cancer treatment, already showing promising results, for instance, using chloroquine or hydroxychloroquine as single agents or in combination therapies [5][6]. Nevertheless, the role of autophagy in cancer is somewhat controversial. Cytotoxic or cytoprotective roles have been reported depending on the cellular context [7]. Therefore, the deep understanding of autophagy regulation and the identification of its role in each cellular context is crucial for the selection of an appropriate therapeutic intervention involving autophagy modulation in cancer.

2. Therapeutic Strategies Targeting Autophagy

Modulation of autophagy has emerged as a promising therapeutic option for cancer treatment. Due to the dual role of autophagy in cancer cells, activators as well as inhibitors have been described as feasible chemotherapeutic agents.
In this section, we compiled different therapeutic interventions targeting autophagy, either for its stimulation or for its inhibition (Figure 1).
Figure 1. Mechanism of autophagy. The phases of the process of autophagy (nucleation, elongation, maturation and degradation), with the main proteins that participate in each one, are depicted.Autophagy activators (green) and inhibitors (red) are marked where they interfere with the autophagy process. Numbers correspond to those compounds listed in table 1 and 2, respectively.

2.1. Autophagy Stimulation for Cancer Treatment

Induction of ACD has become an interesting alternative to overcome resistance to apoptosis and to exploit a caspase independent cell death for cancer treatment. In the following sections, compounds for which the mechanism of action is based on stimulating autophagy are described (Table 1).
Table 1. Autophagy activators.
Mechanism of Action/Type Name Structure Number in Figure 1 Refs.
mTOR Inhibitors Rapacmycin Cancers 11 01599 i001 1 [8][9][10][11]
Temsirolimus (CCI779) Cancers 11 01599 i002 2 [12][13]
Everolimus (RAD001) Cancers 11 01599 i003 3 [14][15]
AZD8055 Cancers 11 01599 i004 4 [16][17]
BH3 Mimetics (-)-gossypol (AT-101) Cancers 11 01599 i005 5 [18][19][20][21]
Obatoclax (GX15-070) Cancers 11 01599 i006 6 [22][23][24]
ABT-737 Cancers 11 01599 i007 7 [25]
Cannabinoids Δ9-Tetrahydrocannabinol (THC) Cancers 11 01599 i008 8 [26][27][28]
JWH-015 Cancers 11 01599 i009 9 [29]
Histone Deacetylase Inhibitors Suberoylanilide hydroxamic acid (SAHA, Vorinostat) Cancers 11 01599 i010 10 [30]
MHY2256 Cancers 11 01599 i011 11 [31]
Natural Products Betulinic acid Cancers 11 01599 i012 12 [32]
Resveratrol Cancers 11 01599 i013 13 [33]
δ-Tocotrienol Cancers 11 01599 i014 14 [34]
Curcumin Cancers 11 01599 i015 15 [35]
Others Lapatinib Cancers 11 01599 i016 16 [36][37]
APO866 Cancers 11 01599 i017 17 [38]

2.1.1. mTOR Inhibitors

The mTOR is a protein kinase that participates in multiple cellular processes such as cell growth, survival, metabolism, and immunity. Thus, mTOR regulates several cellular mechanisms including cell cycle, apoptosis, and autophagy [39], inhibiting the initiation of the latter process [40]. Rapamycin (sirolimus), a secondary metabolite isolated from Streptomyces hygroscopicus, showed potent antifungal, antitumor, and immunosuppressive properties [41][42]. Rapamycin and its semi-synthetic analogues, known as rapalogs, are allosteric selective inhibitors of mTORC1 affecting downstream targets, including the activation of autophagy [43][44]. However, their efficacy inhibiting tumor growth is limited due to lack of inhibition of mTORC2 and other compensatory signaling pathways that promote cell survival [45].
Rapamycin has shown to inhibit proliferation and induce ACD in murine sarcoma [8], neuroblastoma [9], lung cancer [10], and osteosarcoma [11]. Conversely, the rapalog temsirolimus or cell cycle inhibitor-779 (CCI779), has shown to inhibit tumor growth in vitro in adenoid cystic carcinoma [12] but has also shown to stimulate autophagy as a pro-survival mechanism in renal-cell carcinoma [13]. Additionally, everolimus (or RAD001), a derivative rapalog developed for oral administration, has shown to induce cell cycle arrest through autophagy-mediated degradation of cyclin D1 in breast cancer cells [14], but promotes autophagy in aromatase inhibitor-resistant breast cancer cells as a mechanism of resistance [15].
Other types of mTOR inhibitors are compounds that compete with ATP, impeding phosphorylation of its target proteins, resulting in a more efficient inhibition of mTOR [46]. Among them, AZD8055 inhibits both mTOR complexes and has shown to inhibit tumor growth [16] and induce ACD in hepatocellular carcinoma cell lines [17], but it is also capable of limiting tumor growth through induction of apoptosis and cell cycle arrest [47]. Taken together these findings suggest that mTOR inhibitors may act through different mechanisms to induce cell death in a tumor context dependent manner, which makes them suitable for combined therapies to overcome cancer cell resistance [48].

2.1.2. BH3 Mimetics

BH3 (Bcl-2 homology 3) mimetics are a group of small molecules that mimic interactions of BH3-only proteins [49], which are a sub-group of pro-apoptotic proteins in the Bcl-2 family [50]. In general, BH3 mimetics may stimulate autophagy by liberating Beclin-1 from Bcl2 and Bcl-XL inhibition [50][51].
Gossypol is a BH3 mimetic isolated from cotton that has a high affinity for Bcl-2, Bcl-XL, Mcl-1, and Bcl-w [50]. Its orally available enantiomeric form (-)-gossypol (AT-101) has shown to induce ACD in malignant glioma [21], but the induced autophagy has also been accompanied by apoptosis in head and neck squamous cell carcinoma [18], malignant mesothelioma [19], and colon cancer cells [20]. Obatoclax (GX15-070) is another BH3 mimetic that has shown autophagic-mediated necroptosis in oral squamous cell carcinoma [22], rhabdomyosarcoma cells [23], and acute lymphoblastic leukemia cells [24]. Moreover, obatoclax induced autophagy in adenoid cystic carcinoma [52] and Beclin-1 independent autophagy inhibition in colorectal cancer cells [53]. Finally, ABT-737 has shown effectivity in vitro for hepatocellular carcinoma cells in a Beclin-1-dependent autophagy manner [25].

2.1.3. Cannabinoids

Cannabinoids are a group of more than 60 lipophilic ligands for specific cell-surface cannabinoid receptors (CB1 y 2) present in the plant cannabis sativa, with Δ9-Tetrahydrocannabinol (THC) being the main psychoactive compound [54]. Cannabinoids have shown potent anticancer effects related to autophagy, but they have also shown cytoprotective effects depending on cell type and cannabinoid used [55]. THC has shown to activate non-canonical autophagy-mediated apoptosis in melanoma cells [26] and induce ACD in glioma cells through mTORC1 inhibition and autolysosome permeabilization with the consequent release of cathepsins and posterior induction of apoptosis [27][28]. JWH-015 is a synthetic cannabinoid CB2 receptor-selective agonist that has shown to inhibit tumor growth through an autophagy-dependent mechanism in hepatocellular carcinoma cells and in vivo models through inhibition of Akt/mTORC1-pathway via AMPK activation [29].

2.1.4. Histone Deacetylase Inhibitors (HDACIs)

The HDAC family includes four classes (I-IV) of transcriptional repressors that alter the structure of chromatin (via deacetylation) [56] and have been studied as anticancer compounds based on their potential to regulate gene expression [57]. Although apoptosis has been referred to as the main route for HDACIs-induced cancer cell death, autophagy stimulation has also been implicated, being the inactivation of PI3K/Akt/mTOR signaling the most described pathway [58].
Suberoylanilide hydroxamic acid (SAHA, Vorinostat) (a pan HDAC inhibitor) was the first HDACI approved by the FDA for the treatment of cutaneous T-cell lymphoma [59] that has shown to inhibit tumor growth through autophagy stimulation via activation of Cathepsin B in breast cancer cells in vitro [30]. Finally, MHY2256 (a synthetic class III HDAC inhibitor) has shown to induce ACD, cell cycle arrest and apoptosis in endometrial cancer cells in both in vitro and in vivo [31].

2.1.5. Natural Products

Some natural compounds have shown promising anticancer activities based on autophagy stimulation. Betulinic acid is a pentacyclic triterpenoid derived from widespread plants that has shown to induce ACD in multiple myeloma cells with high levels of Bcl-2 expression. This derivative acts as an attenuator for mitochondrial-mediated apoptosis, promoting ACD by inducing Beclin-1 phosphorylation [32]. Resveratrol, a polyphenol compound widely found in plants, has been shown to inhibit cell proliferation in breast cancer stem-like cells via suppressing the Wnt/b-catenin signaling pathway [33]. This pathway, which regulates critical genes in tissue development and homeostasis, is aberrantly activated in many cancers and its inhibition has been reported to be related with autophagy processes [33][60]. δ-Tocotrienol is one of the four isomers that comprises vitamin E that has shown cytotoxic effects against prostate cancer cells in vitro through autophagy activation via ER stress [34]. Curcumin is a major constituent of Curcuma longa (turmeric) that induces autophagy, which has been shown to elicit a dual role protecting or leading to cell death depending on the duration of the treatment and concentration used [35].

2.1.6. Others

Other compounds have been reported to induce ACD in cancer. For example, lapatinib is a small molecule tyrosine kinase inhibitor, targeting epidermal growth factor receptors that is capable of inducing ACD in hepatocellular carcinoma [36] and in acute leukemia cell lines [37]. APO866 is an inhibitor of nicotinamide adenine dinucleotide (NAD) biosynthesis that has shown anticancer activity through induction of ACD in cells from hematological malignancies [38].

2.2. Autophagy Inhibition for Cancer Treatment

In several tumors, autophagy has a protective role; therefore, its inhibition could be an interesting approach for tumor treatment. There are several autophagy inhibitors that block the process of autophagy at different steps, which we detail below (Table 2).
Table 2. Autophagy inhibitors.
Mechanism of Action Name Structure Number in Figure 1 Refs.
ULK Inhibitors Compound 6 Cancers 11 01599 i018 1 [61]
MRT68921 Cancers 11 01599 i019 2 [62][63]
MRT67307 Cancers 11 01599 i020 3 [62][63]
SBI-0206965 Cancers 11 01599 i021 4 [64][65][66][67]
ULK-100 Cancers 11 01599 i022 5 [68]
ULK-101 Cancers 11 01599 i023 6 [68]
Pan PI3k Inhibitors 3MA Cancers 11 01599 i024 7 [69][70][71]
3 MA derivatives Cancers 11 01599 i025 8 [72]
Wortmannin Cancers 11 01599 i026 9 [73][74]
LY294002 Cancers 11 01599 i027 10 [75]
SF1126 Cancers 11 01599 i028 11 [76][77]
PI103 Cancers 11 01599 i029 12 [78]
KU55933 Cancers 11 01599 i030 13 [79]
Gö6976 Cancers 11 01599 i031 14 [79]
GSK1059615 Cancers 11 01599 i032 15 [80][81]
VPS34 (PI3KC3) Inhibitors SAR405 Cancers 11 01599 i033 16 [78]
VPS34-IN1 Cancers 11 01599 i034 17 [82]
PIK-III Cancers 11 01599 i035 18 [83]
Compound 31 Cancers 11 01599 i036 19 [84]
Spautin-1 Cancers 11 01599 i037 20 [85]
ATG Inhibitors ATG7 inhibitor Cancers 11 01599 i038 21 WO2018/089786
ATG7 inhibitor, miR154 UAGGUUAUCCGUGUUGCCUUCG 22 [86]
NSC185058 Cancers 11 01599 i039 23 [87]
Tioconazol Cancers 11 01599 i040 24 [88]
UAMC-2526 Cancers 11 01599 i041 25 [89]
LV320 Cancers 11 01599 i042 26 [90]
S130 Cancers 11 01599 i043 27 [91]
FMK-9a Cancers 11 01599 i044 28 [92][93][94]
Autophagy Formation Verteporfin Cancers 11 01599 i045 29 [95][96][97][98]
Lysosome Inhibitors Lysosomotropic Agents Chloroquine Cancers 11 01599 i046 30 [99][100]
Hydroxychloroquine Cancers 11 01599 i047 31 [101]
Lys05 Cancers 11 01599 i048 32 [102][103]
DQ661 Cancers 11 01599 i049 33 [104]
VATG-027 Cancers 11 01599 i050 34 [105]
Mefloquine Cancers 11 01599 i051 35 [106][107]
Ganoderma lucidum polysaccharide (GLP)   36 [108][109][110]
Vacuolar H+ ATPase Inhibitors Bafilomycin A1 Cancers 11 01599 i052 37 [111][112][113]
Ionophores Tambjamines Cancers 11 01599 i053 38 [114]
Monensin Cancers 11 01599 i054 39 [115]
Squaramides Cancers 11 01599 i055 40 [116]
Inhibition of Autophagosome-Lysosome Fusion WX8 family Cancers 11 01599 i056 41 [117]
Vacuolin-1 Cancers 11 01599 i057 42 [118]
Desmethylclomipramine Cancers 11 01599 i058 43 [119]
Acid Protease Inhibitors Pepstatin A Cancers 11 01599 i059 44 [120]
Leupeptin Cancers 11 01599 i060 45 [120]
E64d Cancers 11 01599 i061 46 [121]
Others Nanoparticles   47 [122][123][124]

2.2.1. ULK Inhibitors

ULKs are a family of serine/threonine protein kinases that form complexes with multiple regulator units. The role of ULK1 is essential for the initiation of autophagy [125][126][127], however the role of ULK2 in autophagy seems to be cell type dependent [128]. Due to the homology between ULK1 and ULK2 [129], inhibitors of ULK1 also inhibit ULK2 [129]. ULK1 has been shown to be upregulated in several cancers, which correlated with poor prognosis and treatment resistance [64][130][131][132]. Inhibition of ULK1 has been shown to induce a decrease in tumor growth and induction of apoptosis [65][66]. This has led to the search for compounds that inhibit this kinase activity finding some molecules that compete with the ATP-binding site, such as compound 6 [61], MRT68921, and MRT67307 [62][63]. Besides them, SBI-0206965 is the most studied [67], which inhibits autophagy and induces apoptosis in neuroblastoma cell lines [65], non-small cell lung cancer (NSCLC) cells [66][67], and in clear cell renal carcinoma cells [64]. Moreover, it has also been reported to be a direct inhibitor of AMPK, which is a serine/threonine kinase that activates the ULK complex, among other roles [133]. Recently more ULK inhibitors, such as ULK100 and ULK101, have been described [68], which supports that the idea that blocking ULK1 may be a good strategy for cancer therapy.

2.2.2. Pan PI3K Inhibitors

The family of phosphoinositide 3-kinases (PI3Ks) is divided into three classes with different substrate preferences, which define their functions. The role of class II on autophagy is unclear. However, class I activates mTORC1 through the PI3K/Akt pathway and consequently inhibits autophagy, while class III (VPS34) activates autophagy [134]. PI3K pathways have been associated with cancer due to their participation in tumorigenic processes such as cell proliferation, survival, migration, and angiogenesis. Therefore, they are a good target for therapy development [135]. Most of the studied PI3K inhibitors are not selective for a specific class of PI3K, hence, they affect different cellular processes, not only autophagy, and consequently their effect cannot be only attributed to inhibition of autophagy. However, due to their therapeutic relevance, we describe briefly some of them below.
3-Methyladenine (3MA) was one of the first inhibitors of autophagy described [69]. It exerts a dual effect on autophagy. Under starving conditions it suppresses autophagy through PI3KC3 inhibition. However, in the presence of nutrients it promotes autophagy by inhibition of PI3KC1 [70]. Additionally, it has been reported that it reduces the expression of drug efflux transporters, overcoming taxol and doxorubicin resistance [71]. 3MA is effective at high concentrations, although presents solubility problems. In order to overcome this limitation some derivatives have been synthetized [72]. Wortmannin is a fungal metabolite that binds irreversibly to the catalytic site of PI3Ks [73][74]. LY294002 is a synthetic small molecule [75] with poor solubility and short half-life. A conjugate analog of LY294002, named SF1126, was designed to accumulate in integrin expressing tissues, improving LY294002 solubility and pharmacokinetic, favoring its accumulation in the tumor site and showing antitumor and antiangiogenic properties in mouse models [76][77]. Other non-selective Pan PI3K inhibitors are PI103 [78], KU55933, Gö6976 [79], and GSK1059615 [80][81][136].

2.2.3. VPS34 (PI3KC3) Complex Inhibitors

VPS34 is a PI3KC3 that transforms PI to PI3P. VPS34 forms a complex with several subunits needed for its activation, such as VPS15 (also known as p150), ATG14, and Beclin-1. Autophagy can be blocked by inhibition of VPS34 activity; SAR405 is one compound of the (2S)-tetrahydropyrimido-pyrimidinones series with kinase inhibitor activity by strong competition for ATP site. However, it is highly selective for PI3KC3, compared to class I and II, and more than 200 protein kinases and 15 lipid kinases. SAR405 inhibits autophagy induced either by starvation or mTOR inhibition [78]. VPS34-IN1 is a bipyrimidinamine that inhibits PI3KC3 selectively, compared with more than 300 protein kinases analyzed [82]. Additionally, PIK-III, a bisaminopyrimidine, binds to a hydrophobic pocket unique in VPS34 that cannot be found in other related kinases [83]. Compound 31 is a small molecule selective against protein and other lipid kinases [84]. All these four inhibitors are selective for PI3KC3, but it should be noted that VPS34 can form different complexes with other subunits that lead to a different localization and function, participating also in vesicle trafficking [137]. Thus, inhibitors of VPS34 can also have an effect on endosomal trafficking, as the case of SAR405 that prevents the activity of both VPS34 complexes [78]. Therefore, it may also affect cellular secretion [138].
On the other hand, autophagy can be also inhibited blocking PI3KC3 complex formation; Spautin-1 indirectly inhibits the activity of VPS34 by proteosomal degradation of proteins that form VPS34 complexes through reduction of Beclin-1 deubiquitination mediated by USP10 and USP13 [85].

2.2.4. ATG inhibitors

Membrane PI3P produced by VPS34 leads to the recruitment of PI3P-binding ATG proteins and additional factors, resulting in the formation of complexes that participate in the elongation of the phagophore. Inhibition of autophagy can be achieved by impeding the formation of these complexes.
ATG7 participates in the formation of the complex ATG12-ATG5 and the conjugation of PE to LC3 and GABARAP. Recently, some inhibitors of ATG7 (WO2018/089786) have been designed and it has extended the use of micro RNAs that target ATG7 gene such as miR-154 that inhibits blade cancer progression [86].
On the other hand, ATG4B cleaves LC3, activating it for its conjugation with PE [139] necessary for the expansion of the autophagosome and its recognition. Additionally, it participates in LC3-PE deconjugation, which is important for LC3 recycling and for the fusion of the autophagosome with the lysosome [140]. Therefore, ATG4B could be a good target to inhibit autophagy more selectively, thus, a large number of ATG4B possible inhibitors have been screened in the last years [141]. NSC185058 is a small compound that docked at the active site of ATG4B inhibiting not only autophagy but also the volume of the autophagosomes, which is accompanied by suppression of tumor growth in an osteosarcoma subcutaneous mouse model [87]. Tioconazole is an antifungal drug that binds to the active site of ATG4 blocking autophagy flux reducing cell viability and sensitizing tumor cells to doxorubicin in a xenograft mouse model [88]. Other ATG4B inhibitors that suppress autophagy in cell lines and in vivo inhibiting cell proliferation are UAMC-2526, a derivative of benzotropolones stable in plasma [89], and LV-320, a styrylquinoline [90].
It should be noticed that the roles of ATG4B in cancer are not well understood and some of the ATG4 inhibitors showed only inhibition in LC3-PE delipidation, but not in the autophagosome formation such as S130 [91] and FMK-9a [92][93][94]. Additionally, some studies are focused on the evaluation of different markers that may predict the effectiveness of those inhibitors [142]. For instance, ATG4B inhibition is effective only in Her-2 positive cells and not in those negative [143].

2.2.5. Autophagosome Formation Inhibition

Verteporfin is a benzoporphyrin derivative used in the clinic in photodynamic therapy. Interestingly, it prevents autophagosome formation induced by glucose and serum deprivation, but not by mTOR inhibition [95]. One possible mechanism of action of verteporfin is the blockade of p62 oligomerization, a protein necessary for the sequestration of ubiquitinated targets into autophagosomes [144][145]. Additional to autophagy inhibition, verteporfin reduces [96][98] transcriptional co-activators that regulate the Hippo pathway, implicated in cell growth and stem cell function [146]. Verteporfin inhibits cell proliferation, angiogenesis, and migration, and induces apoptosis [147]. It inhibits autophagy in vivo but has no effect as a single agent in tumor growth. However, it moderately sensitizes tumor cells to cytotoxic agents [97].

2.2.6. Lysosome Inhibitors

The last step in autophagy is the fusion of autophagosomes with lysosomes, whose hydrolases degrade the autophagosome content. The inhibition of autophagy at this point consists of the use of lysosomal inhibitors.
Chloroquine (CQ) and its analog hydroxychloroquine (HCQ) [101] are drugs used for the treatment of various diseases, such as malaria and more recently cancer [100]. They are weak bases and the unprotonated form of CQ/HCQ can diffuse through cell membranes and enter into organelles such as lysosomes, where the high concentration of H+ induces their protonation and consequently increases lysosomal pH [99]. Once CQ/HCQ are protonated, they are trapped in the lysosomes producing an increase of their volume, and inhibiting the activity of lysosomal enzymes.
CQ and HCQ are the only autophagy inhibitors approved for clinical use. Although short-term CQ/HCQ treatment has been considered safe, retinopathy has been reported produced by long-term treatment with HCQ in about 7.5% of patients [148] and cardiotoxicity [149]. The prevalence depends on the dosage and the duration of treatment [150]. This toxicity limitation, along with inconsistencies in the results obtained in the clinic, have led to the study of new and more potent autophagy inhibitors [151]. Thus, CQ analogs that exert more potent autophagy inhibitory activity have been synthetized. Lys05 is a dimeric analog of CQ that accumulates within acidic organelles, including lysosomes, more potently than HCQ [102]. DQ661, a dimeric quinacrine (DQ), not only inhibits lysosomal catabolism, including autophagy, but also targets palmitoyl-protein thioesterase-1, resulting in the inhibition of mTORC1 signaling. DQ661 has shown effects on tumor mouse models alone and it also overcame resistance to gemcitabine [104]. Another antimalaria compound found to inhibit autophagy with antitumoral properties is VATG-027 [105]. On the other hand, mefloquine is also accumulated in lysosomes disrupting autophagy, it induces apoptosis and inhibits multidrug resistance protein1 (MDR1) being effective in multidrug-resistant tumor cells [107]. Mefloquine sensitizes chronic myeloid leukemia (CML) cells derived from patients in chronic phase to TK inhibitors showing selectivity for stem/progenitor tumoral cells to normal cells [106].
CQ and its derivatives are not the only drugs that target lysosomes to inhibit autophagy; GLP (ganoderma lucidum polysaccharide) is a polysaccharide from the fungus Ganoderma lucidium with multiple antitumoral properties [108]. GLP induces apoptosis in cancer cell lines [110] and reduces tumor growth in mouse models [109]. It has recently been seen that GLP impairs autophagy flux by reduction of lysosome acidification and the accumulation of autophagosomes has suggested to be the cause of apoptosis induction [109]. Bafilomycin A (BafA) is a vacuolar-H+ ATPase inhibitor that disrupts the acidification of lysosomes, vesicles, and vacuoles [111][112] by preventing the entry of H+ into these organelles. BafA also inhibits the fusion of autophagosomes with lysosomes, by disruption of Ca2+ gradients implied in this process [113].
Ionophores can also disrupt lysosomal pH, impairing the autophagy process. Tambjamine analogues are anion selective ionophores derived from the naturally occurring tambjamines and induce mitochondrial swelling and autophagy blockade with cytotoxic effects in lung cancer cells and cancer stem cells (CSCs) [114]. Monensin, nigericin, and lasalocid are cation ionophores, but only monensin presents selectivity for lysosomes [115]. Squaramides are synthetic chloride transporters that also induce cell death by apoptosis [116].
On the other hand, the WX8-family comprises five chemical analogs that disrupt the fusion of lysosomes with autophagosomes, lysosomes fission, and sequestration of molecules into the lysosomes without altering their pH. These compounds bind to PIKFYVE phosphoinositide kinase and present potent antitumoral effects on autophagic dependent cells [117]. Vacuolin-1 activates RAB5A blocking the fusion of the autophagosomes with lysosomes, however it also inhibits the fusion of endosomes with lysosomes, resulting in a general endosomal-lysosomal degradation defective [118].
Clomipramine (CM) is a FDA-approved prodrug for the treatment of psychiatric disorders the metabolite of which, desmethylclomipramine (DCMI), impairs autophagic flux blocking lysosomal degradation that sensitizes tumor cells to cancer treatment [119]. DCMI also affects lung CSCs [152]. Additionally, protease inhibitors can also inhibit the lysosomal degradation, such as pepstatin A (aspartyl proteases; cathepsin D and E), Leupeptin [120] and E64d (cysteine proteases; cathepsin B, H, and L) [121]. On the other hand, nanoparticles are usually accumulated into lysosomes by endocytosis internalization, which may cause lysosome impairment [122]. Gold nanoparticles [123] and nanodiamonds have shown to inhibit autophagy by disruption of lysosomal function, which sensitizes tumors to arsenical base therapy [124].
Several studies have suggested that the anti-tumor effects of lysosomal inhibitors may be independent of autophagy inhibition since they also interfere in other cellular mechanisms producing non-autophagy related effects [153][154][155][156][157][158][159][160]. Remarkably, disruption of the lysosomes not only blocks autophagy, but lysosomal permeabilization releases proteases such as cathepsins that are active at cytosolic pH and participate in apoptosis and apoptosis-like and necrosis-like cell death [161][162][163]. Additionally, lysosomes also participate in tumor invasion, hence, these inhibitors have shown to be effective against metastasis [103][164][165][166], targeting cancer stem cells [167], and inducing tumor vessel normalization [168].
As mentioned above, there are efforts to find genetic determinants to sensitivity or resistance to these lysosomal inhibitors. Metastatic cells are more vulnerable to CQ and BafA, suggesting that patients with metastasis could benefit from those treatments [164]. Morgan and coworkers also showed a relationship between the expression of ID4 and metastatic potential. Additionally, overexpression of helicase-like transcription factor (HLTF) seems to be related with the resistance to HCQ, Lys05 and BafA treatment [155] and tumors with the V600E mutation in BRAF (v-Raf murine sarcoma viral oncogene homolog B) present cytoprotective autophagy [169].

References

  1. Deter, R.L.; Baudhuin, P.; Duve, C. de Participation of lysosomes in cellular autophagy induced in rat liver by glucagon. J. Cell Biol. 1967, 35, 11–16.
  2. Mizushima, N. Autophagy: Process and function. Genes Dev. 2007, 21, 2861–2873.
  3. Mizushima, N.; Levine, B.; Cuervo, A.M.; Klionsky, D.J. Autophagy fights disease through cellular self-digestion. Nature 2008, 451, 1069–1075.
  4. Dikic, I.; Elazar, Z. Mechanism and medical implications of mammalian autophagy. Nat. Rev. Mol. Cell Biol. 2018, 19, 349–364.
  5. Chude, C.I.; Amaravadi, R.K. Targeting autophagy in cancer: Update on clinical trials and novel inhibitors. Int. J. Mol. Sci. 2017, 18, 1279.
  6. U.S. National Library of Medicine of Clinical Trials. Available online: https://clinicaltrials.gov/ (accessed on 10 September 2019).
  7. White, E. The role for autophagy in cancer (White, 2015).pdf. J. Clin. Investig. 2015, 125, 42–46.
  8. Shi, H.; Zhang, L.; Zhang, C.; Hao, Y.; Zhao, X. Rapamycin may inhibit murine S180 sarcoma growth by regulating the pathways associated with autophagy and cancer stem cells. J. Cancer Res. Ther. 2019, 15, 398–403.
  9. Lin, X.; Han, L.; Weng, J.; Wang, K.; Chen, T. Rapamycin inhibits proliferation and induces autophagy in human neuroblastoma cells. Biosci. Rep. 2018, 38, 1–8.
  10. Jiang, R.Y.; Pei, H.L.; Gu, W.D.; Huang, J.; Wang, Z.G. Autophagic inhibitor attenuates rapamycin-induced inhibition of proliferation in cultured A549 lung cancer cells. Eur. Rev. Med. Pharmacol. Sci. 2014, 18, 806–810.
  11. Xie, Z.G.; Xie, Y.; Dong, Q.R. Inhibition of the mammalian target of rapamycin leads to autophagy activation and cell death of MG63 osteosarcoma cells. Oncol. Lett. 2013, 6, 1465–1469.
  12. Liu, W.; Huang, S.; Chen, Z.; Wang, H.; Wu, H.; Zhang, D. Temsirolimus, the mTOR inhibitor, induces autophagy in adenoid cystic carcinoma: In vitro and in vivo. Pathol. Res. Pract. 2014, 210, 764–769.
  13. Singla, M.; Bhattacharyya, S. Autophagy as a potential therapeutic target during epithelial to mesenchymal transition in renal cell carcinoma: An in vitro study. Biomed. Pharmacother. 2017, 94, 332–340.
  14. Chen, G.; Ding, X.-F.; Bouamar, H.; Pressley, K.; Sun, L.-Z. Everolimus induces G 1 cell cycle arrest through autophagy-mediated protein degradation of cyclin D1 in breast cancer cells. Am. J. Physiol. Physiol. 2019, 317, C244–C252.
  15. Lui, A.; New, J.; Ogony, J.; Thomas, S.; Lewis-Wambi, J. Everolimus downregulates estrogen receptor and induces autophagy in aromatase inhibitor-resistant breast cancer cells. BMC Cancer 2016, 16, 1–15.
  16. Chresta, C.M.; Davies, B.R.; Hickson, I.; Harding, T.; Cosulich, S.; Critchlow, S.E.; Vincent, J.P.; Ellston, R.; Jones, D.; Sini, P.; et al. AZD8055 is a potent, selective, and orally bioavailable ATP-competitive mammalian target of rapamycin kinase inhibitor with in vitro and in vivo antitumor activity. Cancer Res. 2010, 70, 288–298.
  17. Hu, M.; Huang, H.; Zhao, R.; Li, P.; Li, M.; Miao, H.; Chen, N.; Chen, M. AZD8055 induces cell death associated with autophagy and activation of AMPK in hepatocellular carcinoma. Oncol. Rep. 2014, 31, 649–656.
  18. Benvenuto, M.; Mattera, R.; Masuelli, L.; Taffera, G.; Andracchio, O.; Tresoldi, I.; Lido, P.; Giganti, M.G.; Godos, J.; Modesti, A.; et al. (±)-Gossypol induces apoptosis and autophagy in head and neck carcinoma cell lines and inhibits the growth of transplanted salivary gland cancer cells in BALB/c mice. Int. J. Food Sci. Nutr. 2017, 68, 298–312.
  19. Benvenuto, M.; Mattera, R.; Sticca, J.I.; Rossi, P.; Cipriani, C.; Giganti, M.G.; Volpi, A.; Modesti, A.; Masuelli, L.; Bei, R. Effect of the BH3 mimetic polyphenol (-)-Gossypol (AT-101) on the in vitro and in vivo growth of malignant mesothelioma. Front. Pharmacol. 2018, 9, 1–13.
  20. Lan, L.; Appelman, C.; Smith, A.R.; Yu, J.; Larsen, S.; Marquez, R.T.; Liu, H.; Wu, X.; Gao, P.; Roy, A.; et al. Natural product (-)-gossypol inhibits colon cancer cell growth by targeting RNA-binding protein Musashi-1. Mol. Oncol. 2015, 9, 1406–1420.
  21. Voss, V.; Senft, C.; Lang, V.; Ronellenfitsch, M.W.; Steinbach, J.P.; Seifert, V.; Kögel, D. The pan-Bcl-2 inhibitor (-)-gossypol triggers autophagic cell death in malignant glioma. Mol. Cancer Res. 2010, 8, 1002–1016.
  22. Sulkshane, P.; Teni, T. BH3 mimetic Obatoclax (GX15-070) mediates mitochondrial stress predominantly via MCL-1 inhibition and induces autophagy-dependent necroptosis in human oral cancer cells. Oncotarget 2017, 8, 60060–60079.
  23. Basit, F.; Cristofanon, S.; Fulda, S. Obatoclax (GX15-070) triggers necroptosis by promoting the assembly of the necrosome on autophagosomal membranes. Cell Death Differ. 2013, 20, 1161–1173.
  24. Bonapace, L.; Bornhauser, B.C.; Schmitz, M.; Cario, G.; Ziegler, U.; Niggli, F.K.; Schäfer, B.W.; Schrappe, M.; Stanulla, M.; Bourquin, J.P. Induction of autophagy-dependent necroptosis is required for childhood acute lymphoblastic leukemia cells to overcome glucocorticoid resistance. J. Clin. Investig. 2010, 120, 1310–1323.
  25. Yao, X.; Li, X.; Zhang, D.; Xie, Y.; Sun, B.; Li, H.; Sun, L.; Zhang, X. B-cell lymphoma 2 inhibitor ABT-737 induces Beclin1- and reactive oxygen species-dependent autophagy in Adriamycin-resistant human hepatocellular carcinoma cells. Tumor Biol. 2017, 39, 1–12.
  26. Armstrong, J.L.; Hill, D.S.; McKee, C.S.; Hernandez-Tiedra, S.; Lorente, M.; Lopez-Valero, I.; Anagnostou, M.E.; Babatunde, F.; Corazzari, M.; Redfern, C.P.F.; et al. Exploiting cannabinoid-induced cytotoxic autophagy to drive melanoma cell death. J. Investig. Dermatol. 2015, 135, 1629–1637.
  27. Hernández-Tiedra, S.; Fabriàs, G.; Dávila, D.; Salanueva, Í.J.; Casas, J.; Montes, L.R.; Antón, Z.; García-Taboada, E.; Salazar-Roa, M.; Lorente, M.; et al. Dihydroceramide accumulation mediates cytotoxic autophagy of cancer cells via autolysosome destabilization. Autophagy 2016, 12, 2213–2229.
  28. Salazar, M.; Carracedo, A.; Salanueva, Í.J.; Hernández-Tiedra, S.; Lorente, M.; Egia, A.; Vázquez, P.; Blázquez, C.; Torres, S.; García, S.; et al. Cannabinoid action induces autophagy-mediated cell death through stimulation of ER stress in human glioma cells. J. Clin. Investig. 2009, 119, 1359–1372.
  29. Vara, D.; Salazar, M.; Olea-Herrero, N.; Guzmán, M.; Velasco, G.; Díaz-Laviada, I. Anti-tumoral action of cannabinoids on hepatocellular carcinoma: Role of AMPK-dependent activation of autophagy. Cell Death Differ. 2011, 18, 1099–1111.
  30. Han, H.; Li, J.; Feng, X.; Zhou, H.; Guo, S.; Zhou, W. Autophagy-related genes are induced by histone deacetylase inhibitor suberoylanilide hydroxamic acid via the activation of cathepsin B in human breast cancer cells. Oncotarget 2017, 8, 53352–53365.
  31. De, U.; Son, J.Y.; Sachan, R.; Park, Y.J.; Kang, D.; Yoon, K.; Lee, B.M.; Kim, I.S.; Moon, H.R.; Kim, H.S. A new synthetic histone deacetylase inhibitor, MHY2256, induces apoptosis and autophagy cell death in endometrial cancer cells via p53 acetylation. Int. J. Mol. Sci. 2018, 19, 2743.
  32. Zhou, H.; Luo, W.; Zeng, C.; Zhang, Y.; Wang, L.; Yao, W.; Nie, C. PP2A mediates apoptosis or autophagic cell death in multiple myeloma cell lines. Oncotarget 2017, 8, 80770–80789.
  33. Fu, Y.; Chang, H.; Peng, X.; Bai, Q.; Yi, L.; Zhou, Y.; Zhu, J.; Mi, M. Resveratrol inhibits breast cancer stem-like cells and induces autophagy via suppressing Wnt/β-catenin signaling pathway. PLoS ONE 2014, 9, e102535.
  34. Fontana, F.; Moretti, R.M.; Raimondi, M.; Marzagalli, M.; Beretta, G.; Procacci, P.; Sartori, P.; Montagnani Marelli, M.; Limonta, P. δ-Tocotrienol induces apoptosis, involving endoplasmic reticulum stress and autophagy, and paraptosis in prostate cancer cells. Cell Prolif. 2019, 52, 1–15.
  35. Deng, Q.; Liang, L.; Liu, Q.; Duan, W.; Jiang, Y.; Zhang, L. Autophagy is a major mechanism for the dual effects of curcumin on renal cell carcinoma cells. Eur. J. Pharmacol. 2018, 826, 24–30.
  36. Chen, Y.J.; Chi, C.W.; Su, W.C.; Huang, H.L. Lapatinib induces autophagic cell death and inhibits growth of human hepatocellular carcinoma. Oncotarget 2014, 5, 4845–4854.
  37. Chen, Y.J.; Fang, L.W.; Su, W.C.; Hsu, W.Y.; Yang, K.C.; Huang, H.L. Lapatinib induces autophagic cell death and differentiation in acute myeloblastic leukemia. Onco. Targets. Ther. 2016, 9, 4453–4464.
  38. Ginet, V.; Puyal, J.; Rummel, C.; Aubry, D.; Breton, C.; Cloux, A.J.; Majjigapu, S.R.; Sordat, B.; Vogel, P.; Bruzzone, S.; et al. A critical role of autophagy in antileukemia/lymphoma effects of APO866, an inhibitor of NAD biosynthesis. Autophagy 2014, 10, 603–617.
  39. Hua, H.; Kong, Q.; Zhang, H.; Wang, J.; Luo, T.; Jiang, Y. Targeting mTOR for cancer therapy. J. Hematol. Oncol. 2019, 12, 71.
  40. Noda, T.; Ohsumi, Y. Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. J. Biol. Chem. 1998, 273, 3963–3966.
  41. Sehgal, S.N.; Baker, H.; Vézina, C. Rapamycin (Ay-22,989), a New Antifungal Antibiotic. II. Fermentation, Isolation and Characterization. J. Antibiot. (Tokyo). 1975, 28, 727–732.
  42. Vézina, C.; Kudelski, A.; Sehgal, S.N. Rapamycin (AY 22,989) A NEW ANTIFUNGAL ANTIBIOTIC. J. Antibiot. (Tokyo). 1975, 28, 721–726.
  43. Pattingre, S.; Espert, L.; Biard-Piechaczyk, M.; Codogno, P. Regulation of macroautophagy by mTOR and Beclin 1 complexes. Biochimie 2008, 90, 313–323.
  44. Benjamin, D.; Colombi, M.; Moroni, C.; Hall, M.N. Rapamycin passes the torch: A new generation of mTOR inhibitors. Nat. Rev. Drug Discov. 2011, 10, 868–880.
  45. Chiarini, F.; Evangelisti, C.; Lattanzi, G.; McCubrey, J.A.; Martelli, A.M. Advances in understanding the mechanisms of evasive and innate resistance to mTOR inhibition in cancer cells. Biochim. Biophys. Acta. Mol. Cell Res. 2019, 1866, 1322–1337.
  46. Mao, B.; Gao, S.; Weng, Y.; Zhang, L.; Zhang, L. Design, synthesis, and biological evaluation of imidazo[1,2-b]pyridazine derivatives as mTOR inhibitors. Eur. J. Med. Chem. 2017, 129, 135–150.
  47. Chen, Y.; Lee, C.H.; Tseng, B.Y.; Tsai, Y.H.; Tsai, H.W.; Yao, C.L.; Tseng, S.H. AZD8055 exerts antitumor effects on colon cancer cells by inhibiting mTOR and cell-cycle progression. Anticancer Res. 2018, 38, 1445–1454.
  48. Carew, J.S.; Kelly, K.R.; Nawrocki, S.T. Mechanisms of mTOR inhibitor resistance in cancer therapy. Target. Oncol. 2011, 6, 17–27.
  49. Merino, D.; Kelly, G.L.; Lessene, G.; Wei, A.H.; Roberts, A.W.; Strasser, A. BH3-Mimetic Drugs: Blazing the Trail for New Cancer Medicines. Cancer Cell 2018, 34, 879–891.
  50. Opydo-Chanek, M.; Gonzalo, O.; Marzo, I. Multifaceted anticancer activity of BH3 mimetics: Current evidence and future prospects. Biochem. Pharmacol. 2017, 136, 12–23.
  51. Czabotar, P.E.; Lessene, G.; Strasser, A.; Adams, J.M. Control of apoptosis by the BCL-2 protein family: Implications for physiology and therapy. Nat. Rev. Mol. Cell Biol. 2014, 15, 49–63.
  52. Liang, L.Z.; Ma, B.; Liang, Y.J.; Liu, H.C.; Zhang, T.H.; Zheng, G.S.; Su, Y.X.; Liao, G.Q. Obatoclax induces Beclin 1- and ATG5-dependent apoptosis and autophagy in adenoid cystic carcinoma cells. Oral Dis. 2015, 21, 470–477.
  53. Koehler, B.C.; Jassowicz, A.; Scherr, A.L.; Lorenz, S.; Radhakrishnan, P.; Kautz, N.; Elssner, C.; Weiss, J.; Jaeger, D.; Schneider, M.; et al. Pan-Bcl-2 inhibitor Obatoclax is a potent late stage autophagy inhibitor in colorectal cancer cells independent of canonical autophagy signaling. BMC Cancer 2015, 15, 1–11.
  54. Śledziński, P.; Zeyland, J.; Słomski, R.; Nowak, A. The current state and future perspectives of cannabinoids in cancer biology. Cancer Med. 2018, 7, 765–775.
  55. Costa, L.; Amaral, C.; Teixeira, N.; Correia-Da-Silva, G.; Fonseca, B.M. Cannabinoid-induced autophagy: Protective or death role? Prostaglandins Other Lipid Mediat. 2016, 122, 54–63.
  56. Mrakovcic, M.; Kleinheinz, J.; Fröhlich, L.F. Histone deacetylase inhibitor-induced autophagy in tumor cells: Implications for p53. Int. J. Mol. Sci. 2017, 18, 1883.
  57. Newbold, A.; Falkenberg, K.J.; Prince, H.M.; Johnstone, R.W. How do tumor cells respond to HDAC inhibition? FEBS J. 2016, 283, 4032–4046.
  58. Mrakovcic, M.; Bohner, L.; Hanisch, M.; Fröhlich, L.F. Epigenetic targeting of autophagy via HDAC inhibition in tumor cells: Role of p53. Int. J. Mol. Sci. 2018, 19, 3952.
  59. Mann, B.S.; Johnson, J.R.; Cohen, M.H.; Justice, R.; Pazdur, R. FDA Approval Summary: Vorinostat for Treatment of Advanced Primary Cutaneous T-Cell Lymphoma. Oncologist 2007, 12, 1247–1252.
  60. Wang, J.; Ren, X.R.; Piao, H.; Zhao, S.; Osada, T.; Premont, R.T.; Mook, R.A.; Morse, M.A.; Lyerly, H.K.; Chen, W. Niclosamide-induced Wnt signaling inhibition in colorectal cancer is mediated by autophagy. Biochem. J. 2019, 476, 535–546.
  61. Lazarus, M.B.; Novotny, C.J.; Shokat, K.M. Structure of the human autophagy initiating kinase ULK1 in complex with potent inhibitors. ACS Chem. Biol. 2015, 10, 257–261.
  62. Skah, S.; Richartz, N.; Duthil, E.; Gilljam, K.M.; Bindesbøll, C.; Naderi, E.H.; Eriksen, A.B.; Ruud, E.; Dirdal, M.M.; Simonsen, A.; et al. cAMP-mediated autophagy inhibits DNA damage-induced death of leukemia cells independent of p53. Oncotarget 2018, 9, 30434–30449.
  63. Petherick, K.J.; Conway, O.J.L.; Mpamhanga, C.; Osborne, S.A.; Kamal, A.; Saxty, B.; Ganley, I.G. Pharmacological inhibition of ULK1 kinase blocks mammalian target of rapamycin (mTOR)-dependent autophagy. J. Biol. Chem. 2015, 290, 11376–11383.
  64. Lu, J.; Zhu, L.; Zheng, L.P.; Cui, Q.; Zhu, H.H.; Zhao, H.; Shen, Z.J.; Dong, H.Y.; Chen, S.S.; Wu, W.Z.; et al. Overexpression of ULK1 Represents a Potential Diagnostic Marker for Clear Cell Renal Carcinoma and the Antitumor Effects of SBI-0206965. EBioMedicine 2018, 34, 85–93.
  65. Dower, C.M.; Bhat, N.; Gebru, M.T.; Chen, L.; Wills, C.A.; Miller, B.A.; Wang, H.-G. Targeted Inhibition of ULK1 Promotes Apoptosis and Suppresses Tumor Growth and Metastasis in Neuroblastoma. Mol. Cancer Ther. 2018, 17, 2365–2376.
  66. Tang, F.; Hu, P.; Yang, Z.; Xue, C.; Gong, J.; Sun, S.; Shi, L.; Zhang, S.; Li, Z.; Yang, C.; et al. SBI0206965, a novel inhibitor of Ulk1, suppresses non-small cell lung cancer cell growth by modulating both autophagy and apoptosis pathways. Oncol. Rep. 2017, 37, 3449–3458.
  67. Egan, D.F.; Chun, M.G.H.; Vamos, M.; Zou, H.; Rong, J.; Miller, C.J.; Lou, H.J.; Raveendra-Panickar, D.; Yang, C.-C.; Sheffler, D.J.; et al. Small molecule inhibition of the autophagy kinase ULK1 and identification of ULK1 substrates. Mol. Cell 2015, 59, 285–297.
  68. Martin, K.R.; Celano, S.L.; Solitro, A.R.; Gunaydin, H.; Scott, M.; O’Hagan, R.C.; Shumway, S.D.; Fuller, P.; MacKeigan, J.P. A Potent and Selective ULK1 Inhibitor Suppresses Autophagy and Sensitizes Cancer Cells to Nutrient Stress. iScience 2018, 8, 74–84.
  69. Seglen, P.O.; Gordon, P.B. 3-Methyladenine: Specific inhibitor of autophagic/lysosomal protein degradation in isolated rat hepatocytes. Proc. Natl. Acad. Sci. USA 1982, 79, 1889–1892.
  70. Wu, Y.T.; Tan, H.L.; Shui, G.; Bauvy, C.; Huang, Q.; Wenk, M.R.; Ong, C.N.; Codogno, P.; Shen, H.M. Dual role of 3-methyladenine in modulation of autophagy via different temporal patterns of inhibition on class I and III phosphoinositide 3-kinase. J. Biol. Chem. 2010, 285, 10850–10861.
  71. Zou, Z.; Zhang, J.; Zhang, H.; Liu, H.; Li, Z.; Cheng, D.; Chen, J.; Liu, L.; Ni, M.; Zhang, Y.; et al. 3-Methyladenine can depress drug efflux transporters via blocking the PI3K-AKT-mTOR pathway thus sensitizing MDR cancer to chemotherapy. J. Drug Target. 2014, 22, 839–848.
  72. Wu, Y.; Wang, X.; Guo, H.; Zhang, B.; Zhang, X.B.; Shi, Z.J.; Yu, L. Synthesis and screening of 3-MA derivatives for autophagy inhibitors. Autophagy 2013, 9, 595–603.
  73. Powis, G.; Bonjouklian, R.; Berggren, M.M.; Gallegos, A.; Abraham, R.; Ashendel, C.; Zalkow, L.; Matter, W.F.; Dodge, J.; Grindey, G.; et al. Wortmannin, a Potent and Selective Inhibitor of Phosphatidylinositol-3-kinase. Cancer Res. 1994, 54, 2419–2423.
  74. Thelen, M.; Wymann, M.P.; Langen, H. Wortmannin binds specifically to 1-phosphatidylinositol 3-kinase while inhibiting guanine nucleotide-binding protein-coupled receptor signaling in neutrophil leukocytes. Proc. Natl. Acad. Sci. USA 1994, 91, 4960–4964.
  75. Vlahos, C.J.; Matter, W.F.; Hui, K.Y.; Brown, R.F. A Specific Inhibitor of Phosphatidylinositol 3 Kinase, 2-(4-Morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J. Biol. Chem. 1994, 269, 5241–5248.
  76. Garlich, J.R.; De, P.; Dey, N.; Jing, D.S.; Peng, X.; Miller, A.; Murali, R.; Lu, Y.; Mills, G.B.; Kundra, V.; et al. A vascular targeted pan phosphoinositide 3-kinase inhibitor prodrug, SF1126, with antitumor and antiangiogenic activity. Cancer Res. 2008, 68, 206–215.
  77. Qin, A.; Li, Y.; Zhou, L.; Xing, C.; Lu, X. Dual PI3K-BRD4 Inhibitor SF1126 Inhibits Colorectal Cancer Cell Growth in Vitro and in Vivo. Cell. Physiol. Biochem. 2019, 52, 758–768.
  78. Ronan, B.; Flamand, O.; Vescovi, L.; Dureuil, C.; Durand, L.; Fassy, F.; Bachelot, M.F.; Lamberton, A.; Mathieu, M.; Bertrand, T.; et al. A highly potent and selective Vps34 inhibitor alters vesicle trafficking and autophagy. Nat. Chem. Biol. 2014, 10, 1013–1019.
  79. Farkas, T.; Daugaard, M.; Jäättelä, M. Identification of small molecule inhibitors of phosphatidylinositol 3-kinase and autophagy. J. Biol. Chem. 2011, 286, 38904–38912.
  80. Xie, J.; Li, Q.; Ding, X.; Gao, Y. GSK1059615 kills head and neck squamous cell carcinoma cells possibly via activating mitochondrial programmed necrosis pathway. Oncotarget 2017, 8, 50814–50823.
  81. Bei, S.; Li, F.; Li, H.; Li, J.; Zhang, X.; Sun, Q.; Feng, L. Inhibition of gastric cancer cell growth by a PI3K-mTOR dual inhibitor GSK1059615. Biochem. Biophys. Res. Commun. 2019, 511, 13–20.
  82. Bago, R.; Malik, N.; Munson, M.J.; Prescott, A.R.; Davies, P.; Sommer, E.; Shpiro, N.; Ward, R.; Cross, D.; Ganley, I.G.; et al. Characterization of VPS34-IN1, a selective inhibitor of Vps34, reveals that the phosphatidylinositol 3-phosphate-binding SGK3 protein kinase is a downstream target of class III phosphoinositide 3-kinase. Biochem. J. 2014, 463, 413–427.
  83. Dowdle, W.E.; Nyfeler, B.; Nagel, J.; Elling, R.A.; Liu, S.; Triantafellow, E.; Menon, S.; Wang, Z.; Honda, A.; Pardee, G.; et al. Selective VPS34 inhibitor blocks autophagy and uncovers a role for NCOA4 in ferritin degradation and iron homeostasis in vivo. Nat. Cell Biol. 2014, 16, 1069–1079.
  84. Pasquier, B.; El-Ahmad, Y.; Filoche-Rommé, B.; Dureuil, C.; Fassy, F.; Abecassis, P.Y.; Mathieu, M.; Bertrand, T.; Benard, T.; Barrière, C.; et al. Discovery of (2 S)-8-[(3 R)-3-Methylmorpholin-4-yl]-1-(3-methyl-2-oxobutyl)-2-(trifluoromethyl)-3,4-dihydro-2 H -pyrimido[1,2- a ]pyrimidin-6-one: A novel potent and selective inhibitor of Vps34 for the treatment of solid tumors. J. Med. Chem. 2015, 58, 376–400.
  85. Liu, J.; Xia, H.; Kim, M.; Xu, L.; Li, Y.; Zhang, L.; Cai, Y.; Norberg, H.V.; Zhang, T.; Furuya, T.; et al. Beclin1 Controls the Levels of p53 by Regulating the Deubiquitination Activity of USP10 and USP13. Cell 2011, 147, 223–234.
  86. Zhang, J.; Mao, S.; Wang, L.; Zhang, W.; Zhang, Z.; Guo, Y.; Wu, Y.; Yi, F.; Yao, X. MicroRNA-154 functions as a tumor suppressor in bladder cancer by directly targeting ATG7. Oncol. Rep. 2019, 41, 819–828.
  87. Akin, D.; Wang, S.K.; Habibzadegah-Tari, P.; Law, B.; Ostrov, D.; Li, M.; Yin, X.M.; Kim, J.S.; Horenstein, N.; Dunn, W.A. A novel ATG4B antagonist inhibits autophagy and has a negative impact on osteosarcoma tumors. Autophagy 2014, 10, 2021–2035.
  88. Liu, P.-F.; Hsu, C.-J.; Tseng, H.-H.; Wu, C.-H.; Shu, C.-W.; Tsai, K.-L.; Yang, L.-W.; Tsai, W.-L.; Cheng, J.-S.; Chang, H.-W.; et al. Drug repurposing screening identifies tioconazole as an ATG4 inhibitor that suppresses autophagy and sensitizes cancer cells to chemotherapy. Theranostics 2018, 8, 830–845.
  89. Kurdi, A.; Cleenewerck, M.; Vangestel, C.; Lyssens, S.; Declercq, W.; Timmermans, J.P.; Stroobants, S.; Augustyns, K.; De Meyer, G.R.Y.; Van Der Veken, P.; et al. ATG4B inhibitors with a benzotropolone core structure block autophagy and augment efficiency of chemotherapy in mice. Biochem. Pharmacol. 2017, 138, 150–162.
  90. Bosc, D.; Vezenkov, L.; Bortnik, S.; An, J.; Xu, J.; Choutka, C.; Hannigan, A.M.; Kovacic, S.; Loo, S.; Clark, P.G.K.; et al. A new quinoline-based chemical probe inhibits the autophagy-related cysteine protease ATG4B OPEN. Sci. Rep. 2018, 8, 11653.
  91. Fu, Y.; Hong, L.; Xu, J.; Zhong, G.; Gu, Q.; Gu, Q.; Guan, Y.; Zheng, X.; Dai, Q.; Luo, X.; et al. Discovery of a small molecule targeting autophagy via ATG4B inhibition and cell death of colorectal cancer cells in vitro and in vivo. Autophagy 2019, 15, 295–311.
  92. Qiu, Z.; Kuhn, B.; Aebi, J.; Lin, X.; Ding, H.; Zhou, Z.; Xu, Z.; Xu, D.; Han, L.; Liu, C.; et al. Discovery of Fluoromethylketone-Based Peptidomimetics as Covalent ATG4B (Autophagin-1) Inhibitors. ACS Med. Chem. Lett. 2016, 7, 802–806.
  93. Xu, D.; Xu, Z.; Han, L.; Liu, C.; Zhou, Z.; Qiu, Z.; Lin, X.; Tang, G.; Shen, H.; Aebi, J.; et al. Identification of new ATG4B inhibitors based on a novel high-throughput screening platform. SLAS Discov. 2017, 22, 338–347.
  94. Chu, J.; Fu, Y.; Xu, J.; Zheng, X.; Gu, Q.; Luo, X.; Dai, Q.; Zhang, S.; Liu, P.; Hong, L.; et al. ATG4B inhibitor FMK-9a induces autophagy independent on its enzyme inhibition. Arch. Biochem. Biophys. 2018, 644, 29–36.
  95. Donohue, E.; Tovey, A.; Vogl, A.W.; Arns, S.; Sternberg, E.; Young, R.N.; Roberge, M. Inhibition of autophagosome formation by the benzoporphyrin derivative verteporfin. J. Biol. Chem. 2011, 286, 7290–7300.
  96. Liu-Chittenden, Y.; Huang, B.; Shim, J.S.; Chen, Q.; Lee, S.-J.; Anders, R.A.; Liu, J.O.; Pan, D. Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the oncogenic activity of YAP. Genes Dev. 2012, 26, 1300–1305.
  97. Donohue, E.; Thomas, A.; Maurer, N.; Manisali, I.; Zeisser-Labouebe, M.; Zisman, N.; Anderson, H.J.; Ng, S.S.W.; Webb, M.; Bally, M.; et al. The Autophagy Inhibitor Verteporfin Moderately Enhances the Antitumor Activity of Gemcitabine in a Pancreatic Ductal Adenocarcinoma Model. J. Cancer 2013, 4, 585–596.
  98. Lui, J.W.; Xiao, S.; Ogomori, K.; Hammarstedt, J.E.; Little, E.C.; Lang, D. The efficiency of verteporfin as a therapeutic option in pre-clinical models of melanoma. J. Cancer 2019, 10, 1–10.
  99. Poole, B.; Ohkuma, S. Effect of weak bases on the intralysosomal pH in mouse peritoneal macrophages. J. Cell Biol. 1981, 90, 665–669.
  100. Solomon, V.R.; Lee, H. Chloroquine and its analogs: A new promise of an old drug for effective and safe cancer therapies. Eur. J. Pharmacol. 2009, 625, 220–233.
  101. Shi, T.T.; Yu, X.X.; Yan, L.J.; Xiao, H.T. Research progress of hydroxychloroquine and autophagy inhibitors on cancer. Cancer Chemother. Pharmacol. 2017, 79, 287–294.
  102. McAfee, Q.; Zhang, Z.; Samanta, A.; Levi, S.M.; Ma, X.-H.; Piao, S.; Lynch, J.P.; Uehara, T.; Sepulveda, A.R.; Davis, L.E.; et al. Autophagy inhibitor Lys05 has single-agent antitumor activity and reproduces the phenotype of a genetic autophagy deficiency. Proc. Natl. Acad. Sci. USA 2012, 109, 8253–8258.
  103. Baquero, P.; Dawson, A.; Mukhopadhyay, A.; Kuntz, E.M.; Mitchell, R.; Olivares, O.; Ianniciello, A.; Scott, M.T.; Dunn, K.; Nicastri, M.C.; et al. Targeting quiescent leukemic stem cells using second generation autophagy inhibitors. Leukemia 2019, 33, 981–994.
  104. Rebecca, V.W.; Nicastri, M.C.; Mclaughlin, N.; Fennelly, C.; Ronghe, A.; Nofal, M.; Lim, C.; Witze, E.; Chude, C.I.; Zhang, G.; et al. A unified approach to targeting the lysosome’s degradative and growth signaling roles. Cancer Discov. 2017, 7, 1266–1283.
  105. Goodall, M.L.; Wang, T.; Martin, K.R.; Kortus, M.G.; Kauffman, A.L.; Trent, J.M.; Gately, S.; MacKeigan, J.P. Development of potent autophagy inhibitors that sensitize oncogenic BRAF V600E mutant melanoma tumor cells to vemurafenib. Autophagy 2014, 10, 1120–1136.
  106. Lam Yi, H.; Than, H.; Sng, C.; Cheong, M.A.; Chuah, C.; Xiang, W. Lysosome Inhibition by Mefloquine Preferentially Enhances the Cytotoxic Effects of Tyrosine Kinase Inhibitors in Blast Phase Chronic Myeloid Leukemia. Transl. Oncol. 2019, 12, 1221–1228.
  107. Sharma, N.; Thomas, S.; Golden, E.B.; Hofman, F.M.; Chen, T.C.; Petasis, N.A.; Schönthal, A.H.; Louie, S.G. Inhibition of autophagy and induction of breast cancer cell death by mefloquine, an antimalarial agent. Cancer Lett. 2012, 326, 143–154.
  108. Cheng, S.; Sliva, D. Ganoderma lucidum for cancer treatment: We are close but still not there. Integr. Cancer Ther. 2015, 14, 249–257.
  109. Pan, H.; Wang, Y.; Na, K.; Wang, Y.; Wang, L.; Li, Z.; Guo, C.; Guo, D.; Wang, X. Autophagic flux disruption contributes to Ganoderma lucidum polysaccharide-induced apoptosis in human colorectal cancer cells via MAPK/ERK activation. Cell Death Dis. 2019, 10.
  110. Wu, K.; Na, K.; Chen, D.; Wang, Y.; Pan, H.; Wang, X. Effects of non-steroidal anti-inflammatory drug-activated gene-1 on Ganoderma lucidum polysaccharides-induced apoptosis of human prostate cancer PC-3 cells. Int. J. Oncol. 2018, 53, 2356–2368.
  111. Yamamoto, A.; Tagawa, Y.; Yoshimori, T.; Moriyama, Y.; Masaki, R.; Tashiro, Y. Bafilomycin Ai Prevents Maturation of Autophagic Vacuoles by Inhibiting Fusion between Autophagosomesand Lysosomesin Rat HepatomaCell Line. Cell Struct. Funct. 1998, 23, 33–42.
  112. Bowman, E.J.; Siebers, A.; Altendorf, K. Bafilomycins; A class of inhibitors of membrane ATPases from microorganisms, animal cells, and plant cells. Proc. Natl. Acad. Sci. USA 1988, 85, 7972–7976.
  113. Mauvezin, C.; Neufeld, T.P. Bafilomycin A1 disrupts autophagic flux by inhibiting both V-ATPase-dependent acidification and Ca-P60A/SERCA-dependent autophagosome-lysosome fusion. Autophagy 2015, 11, 1437–1438.
  114. Rodilla, A.M.; Korrodi-Gregório, L.; Hernando, E.; Manuel-Manresa, P.; Quesada, R.; Pérez-Tomás, R.; Soto-Cerrato, V. Synthetic tambjamine analogues induce mitochondrial swelling and lysosomal dysfunction leading to autophagy blockade and necrotic cell death in lung cancer. Biochem. Pharmacol. 2017, 126, 23–33.
  115. Grinde, B. Effect of carboxylic ionophores on lysosomal protein degradation in rat hepatocytes. Exp. Cell Res. 1983, 149, 27–35.
  116. Busschaert, N.; Park, S.H.; Baek, K.H.; Choi, Y.P.; Park, J.; Howe, E.N.W.; Hiscock, J.R.; Karagiannidis, L.E.; Marques, I.; Félix, V.; et al. A synthetic ion transporter that disrupts autophagy and induces apoptosis by perturbing cellular chloride concentrations. Nat. Chem. 2017, 9, 667–675.
  117. Sharma, G.; Guardia, C.M.; Roy, A.; Vassilev, A.; Saric, A.; Griner, L.N.; Marugan, J.; Ferrer, M.; Bonifacino, J.S.; DePamphilis, M.L. A family of PIKFYVE inhibitors with therapeutic potential against autophagy-dependent cancer cells disrupt multiple events in lysosome homeostasis. Autophagy 2019, 15, 1694–1718.
  118. Lu, Y.; Dong, S.; Hao, B.; Li, C.; Zhu, K.; Guo, W.; Wang, Q.; Cheung, K.-H.; Wong, C.W.M.; Wu, W.-T.; et al. Vacuolin-1 potently and reversibly inhibits autophagosome-lysosome fusion by activating RAB5A. Autophagy 2014, 10, 1895–1905.
  119. Rossi, M.; Munarriz, E.R.; Bartesaghi, S.; Milanese, M.; Dinsdale, D.; Guerra-Martin, M.A.; Bampton, E.T.W.; Glynn, P.; Bonanno, G.; Knight, R.A.; et al. Desmethylclomipramine induces the accumulation of autophagy markers by blocking autophagic flux. J. Cell Sci. 2009, 122, 3330–3339.
  120. Libby, P.; Goldberg, A.L. Leupeptin, a protease inhibitor, decreases protein degradation in normal and diseased muscles. Science (80-. ). 1978, 199, 534–536.
  121. Tanida, I.; Minematsu-Ikeguchi, N.; Ueno, T.; Kominami, E. Lysosomal turnover, but not a cellular level, of endogenous LC3 is a marker for autophagy. Autophagy 2005, 1, 84–91.
  122. Stern, S.T.; Adiseshaiah, P.P.; Crist, R.M. Autophagy and lysosomal dysfunction as emerging mechanisms of nanomaterial toxicity. Part. Fibre Toxicol. 2012, 9, 20.
  123. Ma, X.; Wu, Y.; Jin, S.; Tian, Y.; Zhang, X.; Zhao, Y.; Yu, L.; Liang, X.J. Gold nanoparticles induce autophagosome accumulation through size-dependent nanoparticle uptake and lysosome impairment. ACS Nano 2011, 5, 8629–8639.
  124. Cui, Z.; Zhang, Y.; Xia, K.; Yan, Q.; Kong, H.; Zhang, J.; Zuo, X.; Shi, J.; Wang, L.; Zhu, Y.; et al. Nanodiamond autophagy inhibitor allosterically improves the arsenical-based therapy of solid tumors. Nat. Commun. 2018, 9, 4347.
  125. Hosokawa, N.; Hara, T.; Kaizuka, T.; Kishi, C.; Takamura, A.; Miura, Y.; Iemura, S.; Natsume, T.; Takehana, K.; Yamada, N.; et al. Nutrient-dependent mTORC1 Association with the ULK1–Atg13–FIP200 Complex Required for Autophagy. Mol. Biol. Cell 2009, 20, 1981–1991.
  126. Chen, S.; Wang, C.; Yeo, S.; Liang, C.C.; Okamoto, T.; Sun, S.; Wen, J.; Guan, J.L. Distinct roles of autophagy-dependent and -independent functions of FIP200 revealed by generation and analysis of a mutant knock-in mouse model. Genes Dev. 2016, 30, 856–869.
  127. Mercer, C.A.; Kaliappan, A.; Dennis, P.B. A novel, human Atg13 binding protein, Atg101, interacts with ULK1 and is essential for macroautophagy. Autophagy 2009, 5, 649–662.
  128. Lee, E.J.; Tournier, C. The requirement of uncoordinated 51-like kinase 1 (ULK1) and ULK2 in the regulation of autophagy. Autophagy 2011, 7, 689–695.
  129. Chaikuad, A.; Koschade, S.E.; Stolz, A.; Zivkovic, K.; Pohl, C.; Shaid, S.; Ren, H.; Lambert, L.J.; Cosford, N.D.P.; Brandts, C.H.; et al. Conservation of structure, function and inhibitor binding in UNC-51-like kinase 1 and 2 (ULK1/2). Biochem. J. 2019, 2, BCJ20190038.
  130. Yun, M.; Bai, H.Y.; Zhang, J.X.; Rong, J.; Weng, H.W.; Zheng, Z.S.; Xu, Y.; Tong, Z.T.; Huang, X.X.; Liao, Y.J.; et al. ULK1: A promising biomarker in predicting poor prognosis and therapeutic response in human nasopharygeal carcinoma. PLoS ONE 2015, 10, e0117375.
  131. Zou, Y.; Chen, Z.; He, X.; He, X.; Wu, X.; Chen, Y.; Wu, X.; Wang, J.; Lan, P. High expression levels of unc-51-like kinase 1 as a predictor of poor prognosis in colorectal cancer. Oncol. Lett. 2015, 10, 1583–1588.
  132. Jiang, S.; Li, Y.; Zhu, Y.H.; Wu, X.Q.; Tang, J.; Li, Z.; Feng, G.K.; Deng, R.; Li, D.D.; Luo, R.Z.; et al. Intensive expression of UNC-51-like kinase 1 is a novel biomarker of poor prognosis in patients with esophageal squamous cell carcinoma. Cancer Sci. 2011, 102, 1568–1575.
  133. Dite, T.A.; Langendorf, C.G.; Hoque, A.; Galic, S.; Rebello, R.J.; Ovens, A.J.; Lindqvist, L.M.; Ngoei, K.R.W.; Ling, N.X.Y.; Furic, L.; et al. AMP-activated protein kinase selectively inhibited by the type II inhibitor SBI-0206965. J. Biol. Chem. 2018, 293, 8874–8885.
  134. Lindmo, K. Regulation of membrane traffic by phosphoinositide 3-kinases. J. Cell Sci. 2006, 119, 605–614.
  135. Liu, P.; Cheng, H.; Roberts, T.M.; Zhao, J.J. Targeting the phophoinositide 3-kinase(PI3K)pathway in cancer. Nat Rev Drug Discov 2009, 8, 627–644.
  136. Leontieva, O.V.; Blagosklonny, M. V Gerosuppression by pan-mTOR inhibitors. Aging (Albany. NY). 2016, 8, 3535–3551.
  137. Funderburk, S.F.; Wang, Q.J.; Yue, Z. Public Access NIH Public Access. Trends Cell Biol. 2010, 20, 355–362.
  138. Valet, C.; Levade, M.; Chicanne, G.; Bilanges, B.; Cabou, C.; Viaud, J.; Gratacap, M.-P.; Gaits-Iacovoni, F.; Vanhaesebroeck, B.; Payrastre, B.; et al. A dual role for the class III PI3K, Vps34, in platelet production and thrombus growth. Blood 2017, 130, 2032–2042.
  139. Tanida, I.; Sou, Y.S.; Ezaki, J.; Minematsu-Ikeguchi, N.; Ueno, T.; Kominami, E. HsAtg4B/HsApg4B/autophagin-1 cleaves the carboxyl termini of three human Atg8 homologues and delipidates microtubule-associated protein light chain 3- and GABAA receptor-associated protein-phospholipid conjugates. J. Biol. Chem. 2004, 279, 36268–36276.
  140. Yu, Z.Q.; Ni, T.; Hong, B.; Wang, H.Y.; Jiang, F.J.; Zou, S.; Chen, Y.; Zheng, X.L.; Klionsky, D.J.; Liang, Y.; et al. Dual roles of Atg8—PE deconjugation by Atg4 in autophagy. Autophagy 2012, 8, 883–892.
  141. Fu, Y.; Huang, Z.; Hong, L.; Lu, J.H.; Feng, D.; Yin, X.M.; Li, M. Targeting ATG4 in cancer therapy. Cancers 2019, 11, 649.
  142. Tran, E.; Chow, A.; Goda, T.; Wong, A.; Blakely, K.; Rocha, M.; Taeb, S.; Hoang, V.C.; Liu, S.K.; Emmenegger, U. Context-dependent role of ATG4B as target for autophagy inhibition in prostate cancer therapy. Biochem. Biophys. Res. Commun. 2013, 441, 726–731.
  143. Bortnik, S.; Choutka, C.; Horlings, H.M.; Leung, S.; Baker, J.H.E.; Lebovitz, C.; Dragowska, W.H.; Go, N.E.; Bally, M.B.; Minchinton, A.I.; et al. Identification of breast cancer cell subtypes sensitive to ATG4B inhibition. Oncotarget 2016, 7.
  144. Donohue, E.; Balgi, A.D.; Komatsu, M.; Roberge, M. Induction of Covalently Crosslinked p62 Oligomers with Reduced Binding to Polyubiquitinated Proteins by the Autophagy Inhibitor Verteporfin. PLoS ONE 2014, 9, e114964.
  145. Zhang, H.; Ramakrishnan, S.K.; Triner, D.; Centofanti, B.; Maitra, D.; Győrffy, B.; Sebolt-Leopold, J.S.; Dame, M.K.; Varani, J.; Brenner, D.E.; et al. Tumor-selective proteotoxicity of verteporfin inhibits colon cancer progression independently of YAP1. Sci. Signal. 2015, 8, ra98.
  146. Ota, M.; Sasaki, H. Mammalian Tead proteins regulate cell proliferation and contact inhibition as transcriptional mediators of Hippo signaling. Development 2008, 135, 4059–4069.
  147. Wei, H.; Wang, F.; Wang, Y.; Li, T.; Xiu, P.; Zhong, J.; Sun, X.; Li, J. Verteporfin suppresses cell survival, angiogenesis and vasculogenic mimicry of pancreatic ductal adenocarcinoma via disrupting the YAP-TEAD complex. Cancer Sci. 2017, 108, 478–487.
  148. Melles, R.B.; Marmor, M.F. The risk of toxic retinopathy in patients on long-term hydroxychloroquine therapy. JAMA Ophthalmol. 2014, 132, 1453–1460.
  149. Costedoat-Chalumeau, N.; Hulot, J.-S.; Amoura, Z.; Delcourt, A.; Maisonobe, T.; Dorent, R.; Bonnet, N.; Sablé, R.; Lechat, P.; Wechsler, B.; et al. Cardiomyopathy Related to Antimalarial Therapy with Illustrative Case Report. Cardiology 2007, 107, 73–80.
  150. Marmor, M.F.; Kellner, U.; Lai, T.Y.Y.; Melles, R.B.; Mieler, W.F.; Lum, F. Recommendations on Screening for Chloroquine and Hydroxychloroquine Retinopathy (2016 Revision). Ophthalmology 2016, 123, 1386–1394.
  151. Bristol, M.L.; Emery, S.M.; Maycotte, P.; Thorburn, A.; Chakradeo, S.; Gewirtz, D.A. Autophagy inhibition for chemosensitization and radiosensitization in cancer: Do the preclinical data support this therapeutic strategy? J. Pharmacol. Exp. Ther. 2013, 344, 544–552.
  152. Bongiorno-Borbone, L.; Giacobbe, A.; Compagnone, M.; Eramo, A.; De Maria, R.; Peschiaroli, A.; Melino, G. Anti-tumoral effect of desmethylclomipramine in lung cancer stem cells. Oncotarget 2015, 6, 16926–16938.
  153. Boya, P.; Casares, N.; Perfettini, J.; Dessen, P.; Larochette, N.; Métivier, D.; Meley, D.; Souquere, S.; Pierron, G.; Codogno, P.; et al. Inhibition of Macroautophagy Triggers Apoptosis. Mol. Cell. Biol. 2005, 25, 1025–1040.
  154. Verbaanderd, C.; Maes, H.; Schaaf, M.B.; Sukhatme, V.P.; Pantziarka, P.; Sukhatme, V.; Agostinis, P.; Bouche, G. Repurposing drugs in oncology (ReDO)—Chloroquine and hydroxychloroquine as anti-cancer agents. Ecancermedicalscience 2017, 11, 1–35.
  155. Piao, S.; Ojha, R.; Rebecca, V.W.; Samanta, A.; Ma, X.H.; Mcafee, Q.; Nicastri, M.C.; Buckley, M.; Brown, E.; Winkler, J.D.; et al. ALDH1A1 and HLTF modulate the activity of lysosomal autophagy inhibitors in cancer cells. Autophagy 2017, 13, 2056–2071.
  156. Maycotte, P.; Aryal, S.; Ct, C.; Thorburn, J. Chloroquine sensitizes breast cancer cells to chemotherapy independent of autophagy. Autophagy 2012, 8, 200–212.
  157. Eng, C.H.; Wang, Z.; Tkach, D.; Toral-Barza, L.; Ugwonali, S.; Liu, S.; Fitzgerald, S.L.; George, E.; Frias, E.; Cochran, N.; et al. Macroautophagy is dispensable for growth of KRAS mutant tumors and chloroquine efficacy. Proc. Natl. Acad. Sci. USA 2016, 113, 182–187.
  158. Degtyarev, M.; De Mazière, A.; Orr, C.; Lin, J.; Lee, B.B.; Tien, J.Y.; Prior, W.W.; Van Dijk, S.; Wu, H.; Gray, D.C.; et al. Akt inhibition promotes autophagy and sensitizes PTEN-null tumors to lysosomotropic agents. J. Cell Biol. 2008, 183, 101–116.
  159. Kwakye-Berko, F.; Meshnick, S.R. Binding of chloroquine to DNA. Mol. Biochem. Parasitol. 1989, 35, 51–55.
  160. Loehberg, C.R.; Strissel, P.L.; Dittrich, R.; Strick, R.; Dittmer, J.; Dittmer, A.; Fabry, B.; Kalender, W.A.; Koch, T.; Wachter, D.L.; et al. Akt and p53 are potential mediators of reduced mammary tumor growth by Chloroquine and the mTOR inhibitor RAD001. Biochem. Pharmacol. 2012, 83, 480–488.
  161. Enzenmüller, S.; Gonzalez, P.; Debatin, K.M.; Fulda, S. Chloroquine overcomes resistance of lung carcinoma cells to the dual PI3K/mTOR inhibitor PI103 by lysosome-mediated apoptosis. Anticancer. Drugs 2013, 24, 14–19.
  162. Kroemer, G.; Jäättelä, M. Lysosomes and autophagy in cell death control. Nat. Rev. Cancer 2005, 5, 886–897.
  163. Carew, J.S.; Nawrocki, S.T.; Kahue, C.N.; Zhang, H.; Yang, C.; Chung, L.; Houghton, J.A.; Huang, P.; Giles, F.J.; Cleveland, J.L. Targeting autophagy augments the anticancer activity of the histone deacetylase inhibitor SAHAto overcome Bcr-Abl-mediated drug resistance. Blood 2007, 110, 313–322.
  164. Morgan, M.J.; Fitzwalter, B.E.; Owens, C.R.; Powers, R.K.; Sottnik, J.L.; Gamez, G.; Costello, J.C.; Theodorescu, D.; Thorburn, A. Metastatic cells are preferentially vulnerable to lysosomal inhibition. Proc. Natl. Acad. Sci. USA 2018, 115, E8479–E8488.
  165. Fennelly, C.; Amaravadi, R.K. Lysosomal Biology in Cancer. Methods Mol Biol 2017, 1594, 293–308.
  166. Uhlman, A.; Folkers, K.; Liston, J.; Pancholi, H.; Hinton, A. Effects of Vacuolar H(+)-ATPase Inhibition on Activation of Cathepsin B and Cathepsin L Secreted from MDA-MB231 Breast Cancer Cells. Cancer Microenviron. 2017, 10, 49–56.
  167. Balic, A.; Sørensen, M.D.; Trabulo, S.M.; Sainz, B.; Cioffi, M.; Vieira, C.R.; Miranda-Lorenzo, I.; Hidalgo, M.; Kleeff, J.; Erkan, M.; et al. Chloroquine Targets Pancreatic Cancer Stem Cells via Inhibition of CXCR4 and Hedgehog Signaling. Mol. Cancer Ther. 2014, 13, 1758–1771.
  168. Maes, H.; Kuchnio, A.; Peric, A.; Moens, S.; Nys, K.; DeBock, K.; Quaegebeur, A.; Schoors, S.; Georgiadou, M.; Wouters, J.; et al. Tumor vessel normalization by chloroquine independent of autophagy. Cancer Cell 2014, 26, 190–206.
  169. Mulcahy Levy, J.M.; Thompson, J.C.; Griesinger, A.M.; Amani, V.; Donson, A.M.; Birks, D.K.; Morgan, M.J.; Mirsky, D.M.; Handler, M.H.; Foreman, N.K.; et al. Autophagy Inhibition ImprovesChemosensitivity in BRAFV600E Brain Tumors. Cancer Discov 2014, 4, 773–780.
More
Upload a video for this entry
Information
Subjects: Oncology
Contributor MDPI registered users' name will be linked to their SciProfiles pages. To register with us, please refer to https://encyclopedia.pub/register : Vanessa Soto-Cerrato
View Times: 1.5K
Revisions: 3 times (View History)
Update Date: 22 Sep 2021
Notice
You are not a member of the advisory board for this topic. If you want to update advisory board member profile, please contact office@encyclopedia.pub.
OK
Confirm
Only members of the Encyclopedia advisory board for this topic are allowed to note entries. Would you like to become an advisory board member of the Encyclopedia?
Yes
No
${ textCharacter }/${ maxCharacter }
Submit
Cancel
There is no comment~
${ textCharacter }/${ maxCharacter }
Submit
Cancel
${ selectedItem.replyTextCharacter }/${ selectedItem.replyMaxCharacter }
Submit
Cancel
Confirm
Are you sure to Delete?
Yes No
Academic Video Service

Quick Survey

Encyclopedia MDPI is conducting a targeted survey to identify the specific barriers hindering efficient research. We invite you to spend 3 minutes defining the priorities for our next generation of structured knowledge tools.
Take Survey