Your browser does not fully support modern features. Please upgrade for a smoother experience.
Submitted Successfully!
Thank you for your contribution! You can also upload a video entry or images related to this topic. For video creation, please contact our Academic Video Service.
Version Summary Created by Modification Content Size Created at Operation
1 handwiki Camila Xu -- 1201 2022-11-28 01:37:35

Video Upload Options

We provide professional Academic Video Service to translate complex research into visually appealing presentations. Would you like to try it?
Cite
If you have any further questions, please contact Encyclopedia Editorial Office.
HandWiki. Rudivirus. Encyclopedia. Available online: https://encyclopedia.pub/entry/36795 (accessed on 24 June 2026).
HandWiki. Rudivirus. Encyclopedia. Available at: https://encyclopedia.pub/entry/36795. Accessed June 24, 2026.
HandWiki. "Rudivirus" Encyclopedia, https://encyclopedia.pub/entry/36795 (accessed June 24, 2026).
HandWiki. (2022, November 28). Rudivirus. In Encyclopedia. https://encyclopedia.pub/entry/36795
HandWiki. "Rudivirus." Encyclopedia. Web. 28 November, 2022.
Rudivirus
Edit

Rudivirus is a genus of viruses in the order Ligamenvirales; it is the only genus in the family Rudiviridae. These viruses are non-enveloped, stiff-rod-shaped viruses with linear dsDNA genomes, that infect hyperthermophilic archaea of the kingdom Crenarchaeota. There are currently three species in this genus including the type species Sulfolobus islandicus rod-shaped virus 2. The family name derives from the Latin rudis, thin rod, referring to the virion shape.

ligamenvirales rudiviridae sulfolobus

1. Details

  • Main species
    • Sulfolobus islandicus rod-shaped virus 1, SIRV1; genome sequence accession no. AJ414696.
    • Sulfolobus islandicus rod-shaped virus 2, SIRV2; genome sequence accession no. AJ344259.
    • Acidianus rod-shaped virus 1, ARV1; genome sequence accession no. AJ875026.
  • Other species
    • Stygiolobus rod-shaped virus, SRV, genome sequence accession no. FM164764.

The two main species, viruses SIRV1 and SIRV2, were produced by colony-cloned Sulfolobus islandicus strains. The two strains were isolated from samples taken in 1994 from different solfataric fields in Iceland, the Kverkfjöll and Hveragerði, which are separated by a distance of 250 km. These Icelandic solfataric acidic hot springs reach a temperature of 88 °C and pH 2.5. As for its stability in many hosts, SIRV2 is a better candidate for the type species than SIRV1.[1]

Acidianus rod-shaped virus 1, ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy in 2005.[2]

The Stygiolobus rod-shaped virus, SRV, which infects a hyperthermophilic Stygiolobus species, was isolated from a hot spring in the Azores, Portugal in 2008.[3]

Members of the Rudiviridae share structural and genomic characteristics with viruses from the Lipothrixviridae family, which contains enveloped flexible filamentous viruses. Viruses from the two families have linear dsDNA genomes and share up to nine genes. In addition, the filamentous particles of rudiviruses and lipothrixviruses are built from structurally similar, homologous major capsid proteins. Due to these shared properties viruses from the two families are classified into an order Ligamenvirales.[4] Furthermore, members of the Ligamenvirales are structurally related to viruses of the family Tristromaviridae which, similar to lipothrixviruses, are enveloped and encode two paralogous major capsid proteins with the same fold as those of rudiviruses and lipothrixviruses. [5] Due to these structural similarities, order Ligamenvirales and family Tristromaviridae were proposed to be unified within a class 'Tokiviricetes' (toki means ‘thread’ in Georgian and viricetes is an official suffix for a virus class).

2. Structure

Virions are non-enveloped, consisting of a tube-like superhelix formed by dsDNA and the major structural protein, with plugs at each end to which three tail fibers are anchored. These tail fibers appear to be involved in adsorption onto the host cell surface and are formed by one of the minor structural proteins.

Both Sulfolobus islandicus rod-shaped viruses are stiff rods of about 23 nm in width, but differing in length—SIRV1 is about 830 nm and SIRV2 is about 900 nm long. They present a central channel of approx. 6 nm that encapsidates the DNA genome. At each terminus of the rod there is a plug of approx. 48 nm in length and 6 nm in diameter that fills the terminal portion of the cavity, together with three tail fibres of approx. 28 nm in length.

A three-dimensional reconstruction of the SIRV2 virion at ~4 angstrom resolution has been obtained by cryo–electron microscopy.[6] The structure revealed a previously unknown form of virion organization, in which the alpha-helical major capsid protein of SIRV2 wraps around the DNA, making it inaccessible to solvent. The viral DNA was found to be entirely in the A-form, which suggests a common mechanism with bacterial spores for protecting DNA in the most adverse environments.

Acidianus rod-shaped virus 1 is 610 nm long and 22 nm wide, also has the three tail fibers protruding at each end and the same central channel encapsidating the genome.

The Stygiolobus rod-shaped virus displays a similar rod-shaped morphology, sizing 702 nm by 22 nm.

Genus Structure Symmetry Capsid Genomic arrangement Genomic segmentation
Rudivirus Rod-shaped Helical Non-enveloped Linear Monopartite

[7]

3. Genome

The rudiviral genome is composed of linear dsDNA and ranges from 24 kb (ARV1) to 35 kb (SIRV2). The two strands of the linear genomes are covalently linked and, at both ends of the genome, there are inverted terminal repeats. The Sulfolobus rudiviruses size up to 32.3 kbp for SIRV1 and 35.8 kbp for SIRV2, with inverted terminal repeats of 2029 bp at the ends of the linear genome. The G+C content of both genomes is extremely low, of only 25%, whereas the genome of Sulfolobus solfataricus (the sequenced genome closest to the virus host) hits 37%.

The genome sequence and composition of ARV1 differs strongly from those of the Sulfolobus rudiviruses. ARV1 has a genome of 24,655 bp, including 1365 bp inverted terminal repeats at both ends.

SRV shows sufficient genomical differences from the other rudiviruses to warrant its classification as a novel species. Its genome totals 28,096 bp and presents inverted terminal repeats of 1,030 bp.

Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends, which may constitute a signal for the Holliday junction resolvase [8] and DNA replication.

4. Transcriptional Patterns and Transcription Regulation

The transcriptional patterns of the rudiviruses SIRV1 and SIRV2 are relatively simple, with few temporal expression differences.[9] In contrast, at least 10% of its genes were predicted to have of different DNA binding motifs in the proteins they code and were assigned to be putative transcriptional regulators.[10] A high proportion of viral genes coding for DNA binding proteins with the ribbon-helix-helix (RHH) DNA binding motifs has been suggested. The abundance of genes coding for proteins belonging to the RHH superfamily present in the genomes of crenarchaea and their viruses could underline the important role of these proteins in host and viral gene transcription regulation under harsh conditions.

Protein SvtR [11] was the first crenarchaeal RHH regulator characterized in details and also the first viral coded transcriptional regulators within the Archaeal domain. It strongly represses the transcription of the minor structural protein and, to a lesser extent, of its own gene. The structure is very similar to that of bacterial RHH proteins despite the low sequence similarity, such as CopG, a bacterial plasmid copy number control regulator.

A Sulfolobus islandicus coded transcription activator, Sta1, has also been shown to activate transcription of several viral genes.[12]

5. Viral Life Cycle

Sulfolobus islandicus rod-shaped virus 2 (SIRV2) recognizes its host by binding to type 4 pili abundantly present on the cell surface.[13][14] The virus initially binds to the tip of the pilus and subsequently advances along the pilus to the cell surface, where virion disassembles and SIRV2 genome is internalized by an unknown mechanism.[13] SIRV2 is a lytic virus that kills the host cell as a consequence of elaborated mechanisms orchestrated by the virus. Massive degradation of the host chromosomes occurs because of virus infection and virion assembly occurs in the cytoplasm. Virions are released from the host cell through a mechanism that involves the formation of specific cellular structures.[15]

Genus Host details Tissue tropism Entry details Release details Replication site Assembly site Transmission
Rudivirus Hyperthermophilic archaea: Sulfolobus islandicus None Adsorption to type 4 pili Lysis Cytoplasm Cytoplasm Contact

[7]

6. Potential Applications in Nanotechnology

SIRV2 can act as a template for site-selective and spatially controlled chemical modification. Both the ends and the body of the virus, or the ends only, can be chemically addressed, thus SIRV2 can be regarded as a structurally unique nanobuilding block.[16]

References

  1. Prangishvili, David; Peter Arnold, Hans; Götz, Dorothee; Ziese, Ulrike; Holz, Ingelore; Kristjansson, Jakob K.; Zillig, Wolfram (1999). "A Novel Virus Family, the Rudiviridae: Structure, Virus-Host Interactions and Genome Variability of the Sulfolobus Viruses SIRV1 and SIRV2". Genetics 152 (4): 1387–1396. PMID 10430569.  http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1460677
  2. Vestergaard, G.; Häring, M.; Peng, X.; Rachel, R.; Garrett, R. A.; Prangishvili, D. (2005). "A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus". Virology 336 (1): 83–92. doi:10.1016/j.virol.2005.02.025. PMID 15866073.  https://dx.doi.org/10.1016%2Fj.virol.2005.02.025
  3. Vestergaard, G.; Shah, S. A.; Bize, A.; Reitberger, W.; Reuter, M.; Phan, H.; Briegel, A.; Rachel, R. et al. (2008). "Stygiolobus Rod-Shaped Virus and the Interplay of Crenarchaeal Rudiviruses with the CRISPR Antiviral System". J. Bacteriol. 190 (20): 6837–6845. doi:10.1128/jb.00795-08. PMID 18723627.  http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2566220
  4. "A new proposed taxon for double-stranded DNA viruses, the order "Ligamenvirales"". Arch Virol 157 (4): 791–795. 2012. doi:10.1007/s00705-012-1229-7. PMID 22270758.  https://dx.doi.org/10.1007%2Fs00705-012-1229-7
  5. Wang, F; Baquero, DP; Su, Z; Osinski, T; Prangishvili, D; Egelman, EH; Krupovic, M (January 2020). "Structure of a filamentous virus uncovers familial ties within the archaeal virosphere". Virus Evolution 6 (1): veaa023. doi:10.1093/ve/veaa023. PMID 32368353. PMC 7189273. https://academic.oup.com/ve/article/6/1/veaa023/5826649. 
  6. DiMaio F, Yu X, Rensen E, Krupovic M, Prangishvili D, Egelman EH (2015). "A virus that infects a hyperthermophile encapsidates A-form DNA". Science 348 (6237): 914–917. doi:10.1126/science.aaa4181. PMID 25999507. Bibcode: 2015Sci...348..914D.  http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=5512286
  7. "Viral Zone". ExPASy. http://viralzone.expasy.org/all_by_species/578.html. Retrieved 15 June 2015. 
  8. Birkenbihl, R.P; Neef, K; Prangishvili, D; Kemper, B (2001). "Holliday junction resolving enzymes of archaeal viruses SIRV1 and SIRV2". Journal of Molecular Biology 309 (5): 1067–76. doi:10.1006/jmbi.2001.4761. PMID 11399079.  https://dx.doi.org/10.1006%2Fjmbi.2001.4761
  9. Kessler, Alexandra; Brinkman, Arie B.; John; Prangishvili, David (November 2004). "Transcription of the Rod-Shaped Viruses SIRV1 and SIRV2 of the Hyperthermophilic Archaeon Sulfolobus". J Bacteriol 186 (22): 7745–7753. doi:10.1128/JB.186.22.7745-7753.2004. PMID 15516589.  http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=524901
  10. Prangishvili, David; Garrett, Roger A.; Koonin, Eugene V. (2006). "Evolutionary genomics of archaeal viruses: Unique viral genomes in the third domain of life". Virus Research 117 (1): 52–67. doi:10.1016/j.virusres.2006.01.007. PMID 16503363.  https://dx.doi.org/10.1016%2Fj.virusres.2006.01.007
  11. Guilliere, Florence; Peixeiro, Nuno; Kessler, Alexandra; Raynal, Bertrand; Desnoues, Nicole; Keller, Jenny; Delepierre, Muriel; Prangishvili, David et al. (August 2009). "Structure, function and targets of the transcriptional regulator SvtR from the hyperthermophilic archaeal virus SIRV1". J Biol Chem 284 (33): 22222–37. doi:10.1074/jbc.m109.029850. PMID 19535331.  http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2755947
  12. Kessler, Alexandra; Sezonov, Guennadi; Guijarro, J. Iñaki; Desnoues, Nicole; Rose, Thierry; Delepierre, Muriel; Bell, Stephen D.; Prangishvili, David (2006). "A novel archaeal regulatory protein, Sta1, activates transcription from viral promoters". Nucleic Acids Res 34 (17): 4837–4845. doi:10.1093/nar/gkl502. PMID 16973899.  http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1635249
  13. Quemin, ER; Lucas, S; Daum, B; Quax, TE; Kühlbrandt, W; Forterre, P; Albers, SV; Prangishvili, D et al. (2013). "First insights into the entry process of hyperthermophilic archaeal viruses.". Journal of Virology 87 (24): 13379–85. doi:10.1128/JVI.02742-13. PMID 24089554.  http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=3838266
  14. Wang, F; Cvirkaite-Krupovic, V; Kreutzberger, MAB; Su, Z; de Oliveira, GAP; Osinski, T; Sherman, N; DiMaio, F et al. (2019). "An extensively glycosylated archaeal pilus survives extreme conditions.". Nature Microbiology 4 (8): 1401–1410. doi:10.1038/s41564-019-0458-x. PMID 31110358.  http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=6656605
  15. Bize, Ariane; Karlsson, Erik A.; Ekefjärd, Karin; Quax, Tessa E. F.; Pina, Mery; Prevost, Marie-Christine; Forterre, Patrick; Tenaillon, Olivier et al. (2009). "A unique virus release mechanism in the Archaea". PNAS 106 (27): 11306–11311. doi:10.1073/pnas.0901238106. PMID 19549825. Bibcode: 2009PNAS..10611306B.  http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2708744
  16. Steinmetz, N.F., Bize, A., Findlay, K.C., Lomonossoff, G.P., Manchester, M., Evans, D.J. and Prangishvili, D. (2008) Site-specific and spatially controlled addressability of a new viral nanobuilding block: Sulfolobus islandicus rod-shaped virus 2. Adv. Funct. Mater. 18, 3478–3486
More
Upload a video for this entry
Information
Subjects: Microbiology
Contributor MDPI registered users' name will be linked to their SciProfiles pages. To register with us, please refer to https://encyclopedia.pub/register :
View Times: 813
Entry Collection: HandWiki
Revision: 1 time (View History)
Update Date: 28 Nov 2022
Notice
You are not a member of the advisory board for this topic. If you want to update advisory board member profile, please contact office@encyclopedia.pub.
OK
Confirm
Only members of the Encyclopedia advisory board for this topic are allowed to note entries. Would you like to become an advisory board member of the Encyclopedia?
Yes
No
${ textCharacter }/${ maxCharacter }
Submit
Cancel
There is no comment~
${ textCharacter }/${ maxCharacter }
Submit
Cancel
${ selectedItem.replyTextCharacter }/${ selectedItem.replyMaxCharacter }
Submit
Cancel
Confirm
Are you sure to Delete?
Yes No
Academic Video Service

Quick Survey

Encyclopedia MDPI is conducting a targeted survey to identify the specific barriers hindering efficient research. We invite you to spend 3 minutes defining the priorities for our next generation of structured knowledge tools.
Take Survey