The microRNA (miRNA) Let-7 has been identified as related to glycolysis procedures such as tissue repair, stem cell-derived cardiomyocytes, and tumoral metastasis. In many cancers, the expression of glycolysis-related enzymes is correlated with Let-7, in which multiple enzymes are related to the regulation of the autophagy process. However, much recent research has not comprehensively investigated how Let-7 participates in glycolytic reprogramming or its links to autophagic regulations, mainly in tumor progression.
| Let-7 Family | Sequence |
|---|---|
| Let-7a | UGAGGUAGUAGGUUGUAUAGUU |
| Let-7b | UGAGGUAGUAGGUUGUGUGGUU |
| Let-7c | UGAGGUAGUAGGUUGUAUGGUU |
| Let-7d | AGAGGUAGUAGGUUGCAUAGUU |
| Let-7e | UGAGGUAGGAGGUUGUAUAGUU |
| Let-7f | UGAGGUAGUAGAUUGUAUAGUU |
| Let-7g | UGAGGUAGUAGUUUGUACAGUU |
| Let-7i | UGAGGUAGUAGUUUGUGCUGUU |
| miR-98 | UGAGGUAGUAAGUUGUAUUGUU |
| miR-202 | AGAGGUAGUAGGGCAUGGGAA |
| Cancer Type | Let-7 Family | Clinical Association | Year | Reference |
|---|---|---|---|---|
| Acute Myeloid Leukemia | Let-7a | Associated with poor outcome | 2013 | [16] |
| Let-7a-2-3p | Associated with good outcome | 2015 | [17] | |
| miR-98 | Associated with good outcome | 2019 | [18] | |
| Breast Cancer | Let-7a | Associated with good outcome | 2018 | [19] |
| Let-7a | Associated with good outcome | 2018 | [20] | |
| Let-7a | Associated with good outcome | 2019 | [21] | |
| Let-7a | Associated with good outcome | 2019 | [22] | |
| Let-7a-5p | Associated with good outcome | 2020 | [23] | |
| Let-7b | Associated with good outcome | 2018 | [19] | |
| Let-7b | Associated with good outcome | 2019 | [21] | |
| Let-7b | Associated with good outcome | 2020 | [24] | |
| Let-7b | Associated with good outcome | 2020 | [25] | |
| Let-7b | Associated with good outcome | 2020 | [26] | |
| Let-7b | Associated with good outcome | 2016 | [27] | |
| Let-7c | Associated with good outcome | 2016 | [27] | |
| Let-7c | Associated with good outcome | 2018 | [19] | |
| Let-7c | Associated with good outcome | 2019 | [21] | |
| Let-7c | Associated with poor outcome | 2020 | [28] | |
| Let-7d | Associated with good outcome | 2018 | [19] | |
| Let-7d | Associated with good outcome | 2018 | [29] | |
| Let-7d | Associated with good outcome | 2019 | [21] | |
| Let-7e | Associated with good outcome | 2018 | [19] | |
| Let-7e | Associated with poor outcome | 2019 | [21] | |
| Let-7f | Associated with good outcome | 2018 | [19] | |
| Let-7f | Associated with good outcome | 2019 | [21] | |
| Let-7g | Associated with good outcome | 2011 | [30] | |
| Let-7g | Associated with good outcome | 2018 | [19] | |
| Let-7g | Associated with good outcome | 2019 | [21] | |
| Let-7i | Associated with good outcome | 2008 | [31] | |
| Let-7i | Associated with good outcome | 2018 | [19] | |
| Let-7i | Associated with good outcome | 2019 | [21] | |
| Colon Cancer | Let-7a | Associated with poor outcome | 2017 | [32] |
| Let-7g | Associated with good outcome | 2017 | [33] | |
| Esophageal Cancer | Let-7b | Associated with good outcome | 2012 | [34] |
| Let-7c | Associated with good outcome | 2012 | [34] | |
| Let-7c | Associated with good outcome | 2013 | [35] | |
| Glioblastoma | Let-7a | Associated with good outcome | 2013 | [36] |
| Let-7c | Associated with good outcome | 2021 | [37] | |
| Let-7f | Associated with poor outcome | 2018 | [38] | |
| Let-7i | Associated with good outcome | 2020 | [39] | |
| Liver Cancer | Let-7a | Associated with poor outcome | 2018 | [40] |
| Let-7a | Associated with good outcome | 2020 | [41] | |
| Let-7b | Associated with good outcome | 2020 | [41] | |
| Let-7b | Associated with good outcome | 2020 | [42] | |
| Let-7c | Associated with good outcome | 2020 | [41] | |
| miR-202 | Associated with good outcome | 2020 | [43] | |
| Lung Adenocarcinoma | Let-7b | Associated with good outcome | 2021 | [44] |
| Melanoma | miR-98 | Associated with good outcome | 2014 | [45] |
| Mesothelioma | Let-7c | Associated with good outcome | 2017 | [46] |
| Ovarian Cancer | Let-7b | Associated with poor outcome | 2021 | [47] |
| Let-7d | Associated with poor outcome | 2012 | [48] | |
| Let-7e | Associated with good outcome | 2017 | [49] | |
| Let-7f | Associated with good outcome | 2013 | [50] | |
| Let-7g | Associated with poor outcome | 2016 | [51] | |
| Let-7i | Associated with good outcome | 2008 | [31] | |
| miR-98 | Associated with good outcome | 2021 | [52] | |
| miR-98 | Associated with good outcome | 2020 | [53] | |
| miR-98 | Associated with poor outcome | 2019 | [54] | |
| miR-98 | Associated with poor outcome | 2018 | [55] | |
| miR-202 | Associated with good outcome | 2020 | [56] | |
| Let-7g | Associated with good outcome | 2017 | [57] | |
| Pancreatic Cancer | Let-7e | Associated with good outcome | 2010 | [58] |
| miR-202 | Associated with good outcome | 2021 | [59] | |
| Prostate Cancer | Let-7b | Associated with poor outcome | 2013 | [60] |
| Let-7c | Associated with good outcome | 2013 | [60] |

This entry is adapted from the peer-reviewed paper 10.3390/ijms23010113