Your browser does not fully support modern features. Please upgrade for a smoother experience.
MicroRNA Let-7-Mediated Glycolysis: History
Please note this is an old version of this entry, which may differ significantly from the current revision.

The microRNA (miRNA) Let-7 has been identified as related to glycolysis procedures such as tissue repair, stem cell-derived cardiomyocytes, and tumoral metastasis. In many cancers, the expression of glycolysis-related enzymes is correlated with Let-7, in which multiple enzymes are related to the regulation of the autophagy process. However, much recent research has not comprehensively investigated how Let-7 participates in glycolytic reprogramming or its links to autophagic regulations, mainly in tumor progression.

  • Let-7
  • microRNA
  • autophagy

1. Introduction

Cellular energy-related metabolisms involve complex regulation dynamic processes. The current understanding is that the uptake of glucose from the extracellular environment is a primary way for cells to acquire resources for sustaining energy. Intermediate glucose metabolism can be converted by diverse metabolites of lipids and amino acids to maintain cellular functions [1]. In addition, autophagy is recognized as a digesting process to engulf cellular compartments or damaged organelles for maintaining metabolic homeostasis while responding to multiple metabolic stresses [2]. Within such processes, necessary molecules can be recycled by degrading specific factors to adapt cell growth to a rigorous environment. The glucose metabolic networks regulated by glycolysis and autophagy have explained the fundamental nutrients dynamic for maintaining cell growth and survival. Among them, miRNA, a 18–25-nt single-stranded noncoding RNA, serves as an essential modulator involved in cellular metabolisms, conducting post-transcriptional modification by targeting to 3’UTR of specific mRNA [3].
Let-7 is the first miRNA family identified as involved in multiple cellular and biological functions, including glucose metabolism and autophagy. The glucose metabolism is controlled by the miRNA family of Let-7 directly [4], or regulated by an autophagy-associated glycogen recycling system [5,6]. The imbalance of Let-7-mediated processes of glucose metabolism has been found to contribute to disease progression, especially carcinogenesis. In addition, metabolic dysregulation, which causes excessive energy release for unlimited growth, has been a consequential risk for promoting cancer development. However, the crosstalk networks between autophagy and glucose metabolism—especially the linkage of Let-7 miRNA that participates in carcinogenesis and various biological functions—are still obscure and need to be fully addressed.

2. Involvement of Let-7 in Glycolysis Reprogramming

Let-7 was reported in 1990 and contributes to the embryonic development of C. elegans. The artificial manipulation of the expression of Let-7 causes mortality during embryogenesis [7]. Interestingly, several cancer-associated molecules have been identified from embryonic development, including Let-7. The Let-7 family has been classified by its consensus sequence [8] (Table 1). According to the literatures review, the Let-7 family-related expression was associated with the patient’s prognosis (Table 2). Furthermore, numerous studies have indicated that the related expression of Let-7 is lower in tumor cells, whereas an increased level of Let-7 is able to suppress tumor malignancy, which indicates that Let-7 may contribute to the suppression role in most types of tumors [9,10].
Table 1. The Let-7 family in humans.
Let-7 Family Sequence
Let-7a UGAGGUAGUAGGUUGUAUAGUU
Let-7b UGAGGUAGUAGGUUGUGUGGUU
Let-7c UGAGGUAGUAGGUUGUAUGGUU
Let-7d AGAGGUAGUAGGUUGCAUAGUU
Let-7e UGAGGUAGGAGGUUGUAUAGUU
Let-7f UGAGGUAGUAGAUUGUAUAGUU
Let-7g UGAGGUAGUAGUUUGUACAGUU
Let-7i UGAGGUAGUAGUUUGUGCUGUU
miR-98 UGAGGUAGUAAGUUGUAUUGUU
miR-202 AGAGGUAGUAGGGCAUGGGAA
Table 2. Let-7 family in pan-cancer on the basis of literature review to coordinate the related survival correlation between patients with cancer and the Let-7 family.
Cancer Type Let-7 Family Clinical Association Year Reference
Acute Myeloid Leukemia Let-7a Associated with poor outcome 2013 [16]
Let-7a-2-3p Associated with good outcome 2015 [17]
miR-98 Associated with good outcome 2019 [18]
Breast Cancer Let-7a Associated with good outcome 2018 [19]
Let-7a Associated with good outcome 2018 [20]
Let-7a Associated with good outcome 2019 [21]
Let-7a Associated with good outcome 2019 [22]
Let-7a-5p Associated with good outcome 2020 [23]
Let-7b Associated with good outcome 2018 [19]
Let-7b Associated with good outcome 2019 [21]
Let-7b Associated with good outcome 2020 [24]
Let-7b Associated with good outcome 2020 [25]
Let-7b Associated with good outcome 2020 [26]
Let-7b Associated with good outcome 2016 [27]
Let-7c Associated with good outcome 2016 [27]
Let-7c Associated with good outcome 2018 [19]
Let-7c Associated with good outcome 2019 [21]
Let-7c Associated with poor outcome 2020 [28]
Let-7d Associated with good outcome 2018 [19]
Let-7d Associated with good outcome 2018 [29]
Let-7d Associated with good outcome 2019 [21]
Let-7e Associated with good outcome 2018 [19]
Let-7e Associated with poor outcome 2019 [21]
Let-7f Associated with good outcome 2018 [19]
Let-7f Associated with good outcome 2019 [21]
Let-7g Associated with good outcome 2011 [30]
Let-7g Associated with good outcome 2018 [19]
Let-7g Associated with good outcome 2019 [21]
Let-7i Associated with good outcome 2008 [31]
Let-7i Associated with good outcome 2018 [19]
Let-7i Associated with good outcome 2019 [21]
Colon Cancer Let-7a Associated with poor outcome 2017 [32]
Let-7g Associated with good outcome 2017 [33]
Esophageal Cancer Let-7b Associated with good outcome 2012 [34]
Let-7c Associated with good outcome 2012 [34]
Let-7c Associated with good outcome 2013 [35]
Glioblastoma Let-7a Associated with good outcome 2013 [36]
Let-7c Associated with good outcome 2021 [37]
Let-7f Associated with poor outcome 2018 [38]
Let-7i Associated with good outcome 2020 [39]
Liver Cancer Let-7a Associated with poor outcome 2018 [40]
Let-7a Associated with good outcome 2020 [41]
Let-7b Associated with good outcome 2020 [41]
Let-7b Associated with good outcome 2020 [42]
Let-7c Associated with good outcome 2020 [41]
miR-202 Associated with good outcome 2020 [43]
Lung Adenocarcinoma Let-7b Associated with good outcome 2021 [44]
Melanoma miR-98 Associated with good outcome 2014 [45]
Mesothelioma Let-7c Associated with good outcome 2017 [46]
Ovarian Cancer Let-7b Associated with poor outcome 2021 [47]
Let-7d Associated with poor outcome 2012 [48]
Let-7e Associated with good outcome 2017 [49]
Let-7f Associated with good outcome 2013 [50]
Let-7g Associated with poor outcome 2016 [51]
Let-7i Associated with good outcome 2008 [31]
miR-98 Associated with good outcome 2021 [52]
miR-98 Associated with good outcome 2020 [53]
miR-98 Associated with poor outcome 2019 [54]
miR-98 Associated with poor outcome 2018 [55]
miR-202 Associated with good outcome 2020 [56]
  Let-7g Associated with good outcome 2017 [57]
Pancreatic Cancer Let-7e Associated with good outcome 2010 [58]
  miR-202 Associated with good outcome 2021 [59]
Prostate Cancer Let-7b Associated with poor outcome 2013 [60]
Let-7c Associated with good outcome 2013 [60]
There are divergent theories about how carcinogenesis starts. The monosaccharide glucose is the primary nutritarian for cells. After a meal, insulin increases and stimulates cell response to process glucose metabolism. Once cells uptake glucose, they undergo a process of glycolysis to convert glucose to other intermediates via specific enzymes and generate cellular components, including lipids, amino acids, and energy for cell survival [11]. According to the concept of cancer energy uptake raised by Douglas Hanahan and Robert Weinberg, the dysregulation of metabolism contributes to cancer progression [12]. Studies have demonstrated that the glucose level might change the mitochondria respiration in cells by modulating the expression of the Let-7 level [13]. Comprehensive miRNA profiling from 14 global population studies indicated that the top 1% of population-differentiated miRNA was associated with glucose/insulin metabolism and pathogenesis. MiR-202, as one of the Let-7 family members, may contribute to cancer progression by regulating glucose metabolism [14]. Additionally, Serguienko et al. observed that Let-7 is linked to the expression of Glucose-6-phosphate Dehydrogenase (G6PD), Inosine-5’-monophosphate dehydrogenase 2 (IMPDH2), Fatty Acid Synthase (FASN), stearoyl-CoA desaturase, and Aminoadipate-Semialdehyde Dehydrogenase-Phosphopantetheinyl Transferase (AASDHPPT) from a comparable transcriptome analysis [15]. We herein describe the molecular mechanism of Let-7-mediated glucose metabolism and Let-7-associated metabolic reprogramming impacts in tumor plasticity (Figure 1).
Figure 1. Intermediate mediators/molecules between Let-7-associated glucose metabolism and autophagy.
The diagram summarizes the current participation of the Let-7 family in the regulation of glucose metabolism and autophagy. The direct (marked blue) and indirect (marked red) interrelationship between glycolysis- and autophagy-related pathway were highlighted according to the simulated model. Molecules and factors involved in the biogenesis of Let-7 and the speculation of its interaction with glucose metabolism and autophagic degradation were also illustrated. Possible molecules that regulate the Let-7 homeostasis in between non-carbohydrate metabolism and autophagy processes were indicated.

3. Let-7-Mediated Autophagy Participates in Glucose Metabolism and Cancer Progression

3.1. Let-7 and Autophagy

In lung cancer, Let-7 targets IGF-1R to induce autophagy and blocks the function of BCL2L1/BCL2/PI3K complex to induce apoptosis and pyroptosis and inhibit cell motility [88]. Let-7a targets Rictor’s mTORC2 component, inhibiting AKT/mTORC1 signaling to activate autophagy in gastric cancer [89]. Similar regulation can be observed in human placental trophoblasts, in which the expression of Let-7b was correlated with cell growth and motility. The Let-7b-mediated TGFBR1/ERK/IL-6/TNF-α cascade triggers not only apoptosis but also autophagy. Such regulation may contribute to pre-eclampsia during pregnancy [90]. In glioma, the downregulation of STAT3 was mediated by Let-7a, Let-7d, and Let-7f. Upregulation of Let-7 suppressed the expression of STAT3, resulting in the inhibition of cell proliferation and induction of autophagy and apoptosis [91]. Liang et al. identified that a set of the Let-7 family was downregulated in hepatocellular carcinoma, with different clinical correlations under a genetic profiling analysis. The expression of Let-7b and Let-7c had a better prognosis; Let-7e had a poor prognosis instead. Among them, Let-7e has been demonstrated to promote tumor growth by suppressing autophagy and apoptosis [92]. A similar strategy was used in cholangiocarcinoma. Clinical evidence showed that the expression of NUAK1 was negatively correlated with Let-7a. NUAK1-mediated cholangiocarcinoma cell motility can be suppressed by increasing Let-7a. In turn, the overexpression of Let-7a inhibited NUAK1-mediated tumor malignancy by the induction of autophagy [93]. Additionally, Let-7 can be regulated by LncRNA H19 and LIN28 in breast cancer. The expression of long non-coding RNA (lncRNA) H19 and LIN28 was correlated with breast cancer’s poor prognosis and metastasis ability. Overexpression of H19 and LIN28 increases the expression of several autophagy-related ATG markers as well as its puncta structure formation. Downregulation of Let-7 increased the transcript activity of several EMT-related genes—including Slug, Zeb1, Twist, Snail, β-catenin, and HMGA2—to modulate the metastasis of breast cancer [94]. Another lncRNA MIR99AHG, as well as its Let-7c-associated cluster, were reported to have decreased expression in lung cancer. MIR99AHG increased Let-7c, subsequently promoting autophagy via targeting mTOR, an autophagy suppressor of nucleation, and ANXA2, a negative regulator of elongation, to suppress the growth and motility of lung adenocarcinoma [95]. In view of the controversial role of autophagy in a variety of cancers, the regulation of Let-7-mediated autophagy in tumor progression could be complicated—and condition-, environment-, and tissue-specific.

3.2. Autophagy Activators

Several components have been identified as triggering Let-7-mediated autophagy in cancer cells. Treating cells with recombinant capsid protein viral particle 1 (rVP1) induces autophagy to regulate the motility of macrophages [96] and ovarian cancer cells [97]. In ovarian cancer, autophagy—activated by either a canonical or a rVP1-mediated noncanonical pathway—maintains the homeostasis of the Let-7 level through SQSTM1-mediated degradation of Dicer/AGO2 inhibition of cell migration [97]. In lymphosarcoma, the expression of Let-7g/CTSB may be suppressed by ribonuclease binase to participate in apoptosis and autophagy [98].

3.3. Drug Resistance

In gastric cancer, the expression of miR-202 can be restricted by lncRNA MALAT1, resulting in the activation of autophagy, increased tumor malignancy, and an enhanced drug-resistant ability [99]. In agreement with other reports, Yang et al. showed that paclitaxel-based drug-resistant breast cancer cells express a high level of CircRNA ABCB10 and autophagy, which are correlated with clinical paclitaxel-sensitive or resistant data and negatively associated to Let-7a. Mechanistically, the Let-7a/DUSP7 axis is a downstream effector of Circ-ABCB10 resistant to paclitaxel treatment. Knockdown of Circ-ABCB10 not only increases sensitivity to paclitaxel but also decreases tumor weight [100]. Similar regulation was observed in a cisplatin-based resistance model of A549 with a high level of DICER. Overexpression of DICER induces autophagy processes and increased tumor growth and motility, in which DICER-mediated suppression of Let-7i and the PI3K/AKT/mTOR axis contributes to the autophagy activity [67]. In medulloblastoma, inhibited autophagy was found to promote tumor resistance upon cisplatin treatment. The level of Let-7f in cells was insufficient to repress HMGB1 and led to autophagy-mediated drug resistance. Overexpression of Let-7f could attenuate cisplatin’s drug resistance and induce apoptosis in medulloblastoma cells [101].

3.4. Let-7-Mediated Autophagy in Glucose Metabolism

Recently, Let-7-mediated autophagy has been described as participating in glucose metabolism events. For example, Duan et al. observed that Let-7 targeted BCL-xL to induce autophagic cell death in lung cancer, indicating that Let-7 regulates mitochondria-related autophagy (mitophagy) to regulate metabolism-related events, and BCL-xL with non-apoptotic functions to induce cell death [102]. However, the underlying mechanism of Let-7-mediated autophagy in glucose metabolism that contributes to cell stress and death needs to be further elucidated. According to the above reports, several links may support the correlation between Let-7, autophagy, and glucose metabolism. In turn, Lai et al. found that—in a hypoxic environment—HIF-1α can interact with DICER to regulate miRNA processing in diverse cancer types, including colon, breast, liver, lung, and prostate cancer [103]. HIF-1α changed the glycolysis-related enzyme PDK1 level and induced autophagy-mediated proteolysis by interacting with Parkin/p62 to possess DICER, which decreased Let-7 biogenesis. Overexpression of HIF-1α reduced the levels of Let-7a, Let-7b, and Let-7d as well as its complement downstream target LIN41 and Aurora B to promote tumor metastasis [103]. However, how glycolysis participates in DICER ubiquitination and related autophagy processes has not yet been well explained. So far, Lai et al.’s study provides a possible reason for why the Let-7 level being downregulated under hypoxia is an important factor contributing to tumor microenvironment reprogramming and providing tumor cells with escape from immune surveillance. Recently, bone marrow-derived human mesenchymal stem cells (hMSCs) have been observed to have anticancer activity. Egea et al. found that Let-7f can be transactivated under hypoxia to induce autophagy in hMSCs and promote migration in tumor cells [104]. Let-7f can be regulated by TGF-β, TNF-α, IL-1β, and SDF-1α to modulate CXCR4 and MMP-9 expression and drive chemotactic invasion. Interestingly, hMSCs have been observed to transport Let-7f by exosome secretion to inhibit the growth and motility of breast cancer; such events can be reversed with the Let-7f inhibitor [104].

3.5. mTOR-Dependent Autophagy and Glucose Metabolism

Several studies have found that Let-7 mediates glucose metabolism through the regulation of mammalian target of rapamycin (mTOR) [67,68,76,89]. It is also a well-known negative regulator of autophagy. Notably, human growth hormone receptors (GHR) have played an essential role in glucose metabolism and are linked to mTOR activity. A murine model revealed that, under limited nutrients, growth hormone maintained the cellular glucose level through gluconeogenesis, accompanied by the induction of autophagy [105]. In addition, GHR has been identified to contribute to breast and prostate cancer malignancy [106,107]. Elzein et al. reported that GHR is the target of miR-202. Increased miR-202 suppresses the expression of GHR in MCF and LNCaP cells [108]. Additionally, it has been reported that PKM2 and mTOR expression is downregulated under glucose restriction in breast cancer, which reverses the Warburg effect of cells [109]. Strikingly, these molecules were all be Let-7 downstream effectors. Such regulation may explain how Let-7 mediates autophagy and glucose metabolism to regulate cancer cell progression (Figure 1).

4. Conclusions 

Even though Let-7 was the first miRNA identified, its related biological functions linked to diverse biological processes, including glycolysis and autophagy, remain obscure. The literature review and omics data analysis we performed has generated simulated results to elucidate how Let-7-mediated autophagy participates in glucose metabolism, revealing possible molecules that may participate in this regulatory network. However, the related processes may differ from different genetic backgrounds, cancer types, and therapeutic strategies.

This entry is adapted from the peer-reviewed paper https://doi.org/10.3390/ijms23010113

This entry is offline, you can click here to edit this entry!
Academic Video Service