The active form of vitamin D, 1α,25-(OH)2D3, not only promotes intestinal calcium absorption, but also regulates the formation of osteoclasts (OCs) and their capacity for bone mineral dissolution. Gal-3 is a newly discovered bone metabolic regulator involved in the proliferation, differentiation, and apoptosis of various cells.










Vitamin D is known as the anti-rickets vitamin, and the active form 1α,25-(OH)2D3 is involved in a variety of physiological processes. Among these physiological processes, the most important function is the regulation of calcium homeostasis together with PTH. When serum calcium is low, 1α,25-(OH)2D3 acts with PTH to increase calcium absorption from the intestine. If normal calcium cannot be maintained by intestinal calcium absorption, 1α,25-(OH)2D3 will act with PTH to increase the reabsorption of calcium from the kidney and increase calcium release from the bone stores [32]. Kitazawa et al. [33] also reported that 1α,25-(OH)2D3 increases calcium release from bone stores. They confirmed that 1α,25-(OH)2D3 can increase RANKL expression in stromal cells and support osteoclastogenesis indirectly. In addition, 1α,25-(OH)2D3 can also act directly on OCPs and conversely inhibit OC formation. Consistent with our previous results [34], we demonstrated that 1α,25-(OH)2D3 directly inhibited TRAP-positive OC formation. We also confirmed that 1α,25-(OH)2D3 inhibited the expression of OC-related genes and proteins, including Ctsk, MMP-9, and NFATc1 expression. The bone resorption activity of OCs was also inhibited by 1α,25-(OH)2D3. These data are consistent with those previous studies. For example, Sakai et al. [35] also found that 1α,25-(OH)2D3 inhibits OC formation by inhibiting the expression of c-Fos and NFATc1. Kikuta et al. [36] confirmed that 1α,25-(OH)2D3 and its analogue eldecalcitol promoted OPCs migration and inhibited OC formation by regulating the sphingosine1-phosphate (S1P) receptor system. Thus, we hypothesize that 1α,25-(OH)2D3 can both promote and inhibit OC formation under different circumstances to achieve bone health equilibrium based on previous research. Therefore, the effect of 1α,25-(OH)2D3 on bone health and its underlying mechanism should be further elucidated. In a previous study, we found that gal-3 expression changes during OC formation in the presence of 1α,25-(OH)2D3 by chance [23]. Here, we further confirmed that 1α,25-(OH)2D3 increases gal-3 expression at the protein and mRNA levels. We then used gal-3-knockdown OCPs to evaluate OC formation, bone resorption, and the expression of OC-related genes and proteins.
Gal-3 is the only member of chimera-type galectins and is structurally composed of a large N-terminal domain and one carbohydrate recognition domain (CRD). It contains three structurally distinct domains: (1) a short amino terminal consisting of 12 amino acids with a serine phosphorylation site responsible for its translocation [37]; (2) a collagen-alpha-like nearly 110 amino acid long structure rich in proline, alanine, and glycine; and (3) a C-terminal domain with nearly 140 amino acids encompassing the CRD [38]. It participates in a variety of cellular processes, such as proliferation, differentiation, migration, and apoptosis, and has a variety of biological effects, especially in nephropathy, carcinoma, and the quiescence of hematopoietic stem cells [39][40][41]. It is also an important regulator of bone remodeling. Iacobini et al. [42] found that Lgals3−/− OBs and OCs showed impaired terminal differentiation, reduced mineralization capacity, and resorption activity. They confirmed that gal-3 is an essential factor in normal osteocyte differentiation and activity, bone reconstruction, and biomechanical balance. Simon et al. [24] proved that extracellular gal-3 inhibited OC formation and gal-3-deficient bone marrow cells displayed a higher osteoclastogenic capacity. In the present study, we also found that gal-3-knockdown OCPs showed a stronger OC formation capacity and bone resorption capacity than those of normal OCPs. The expression levels of OC-related genes and proteins, including CTSK, MMP-9, and NFATc1, increased after gal-3 knockdown. As reported previously [24], our data also suggested that gal-3 is a negative regulator of OC formation and activation. In this study, we also found that 1α,25-(OH)2D3 not only inhibited OC formation and activation but also increased gal-3 expression in mRNA and protein levels. However, the mRNA expression of gal-3 in day 5 is lower than that in day 3. This might be relative to mRNA translation and characteristic of protein expression. It has been reported that some of the gal-3 crossed the membrane and translocated into the intracellular vesicles and/or directly onto the cell surface. Furthermore, cell surface-bound and extracellular gal-3 may re-enter the cell by endocytosis and take part in a recycling loop, and is then found in the vesicular non-cytosolic compartments [43]. This may be the cause of the inconsistent expression of gal-3 protein and mRNA, which needs further investigation. When gal-3 expression was inhibited by small interfering RNAs, the inhibitory effect of 1α,25-(OH)2D3 on OC formation and activation was significantly alleviated. These data suggest that gal-3 contributes to 1α,25-(OH)2D3-mediated OC formation and activity. Immunoprecipitation and immunofluorescence assays supported the interaction between gal-3 and VDR protein, further demonstrating that gal-3 might participate in OC formation and activation via interaction with VDR induced by 1α,25-(OH)2D3. However, Nakajima et al. [22] suggested that intact gal-3 promotes OC formation, whereas cleaved gal-3 inhibits OC formation. Therefore, the role of gal-3 in the regulation of OC formation and activation by vitamin D remains to be elucidated. In any case, gal-3 is a potential new target for the prevention of bone disease and maintenance of calcium homeostasis.The isolation and culture of OCPs were based on our previously reported methods with slight improvements [44]. C57BL/6 mice (5–6 weeks old) purchased from the Laboratory Animal Center of Yangzhou University were euthanized. The tibias and femurs were dislocated and the muscles were discarded. The protocol was approved by the Animal Care and Use Committee of Yangzhou University (SYXK[Su], July 20th, 2017] and was carried out in accordance with the Guide for the Care and Use of Laboratory Animals of the National Research Council. The tibias and femurs were cut longitudinally. The bone cavities were flushed with serum-free α-MEM (Gibco, Carlsbad, CA, USA) until they appeared empty. A 1 mL Pasteur pipette and 200 mesh sterile screen were used to disperse any cell aggregates. The liquid was then centrifuged for 10 min at 300× g. The cells that deposited at the bottom of the tube were collected, and red blood cells were removed using ACK Lysing Buffer (Thermo Fisher Scientific, Asheville, NC, USA). Cells were then suspended in α-MEM supplemented with 10% fetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA) and 25 ng/mL M-CSF (416-ML-050, R&D Systems, Minneapolis, MN, USA). The cells were cultured overnight in an incubator at 37 °C under 5% CO2. The supernatant of the culture medium was carefully collected and centrifuged at 500× g for 5 min to obtain BMMs. Then, BMMs were seeded in α-MEM supplemented with 10% FBS and 25 ng/mL M-CSF. They were also incubated at 37°C in 5% CO2. On day 3, suspended cells were removed, and adherent cells were regarded as OCPs.
After the treatment with 25 ng/mL M-CSF for proliferation, 50 ng/mL RANKL (462-TEC-010, R&D Systems) and different concentrations of 1α,25-(OH)2D3 (0.1, 1, and 10 nmol/L) (D5310, Sigma-Aldrich, St. Louis, MO, USA) were added to the culture medium. Anhydrous alcohol was used as a control (0 nmol/L 1α,25-(OH)2D3). Cell viability was determined using the Cell Counting Kit-8 (CCK-8) (Dojindo, Kumamoto, Kyushu, Japan).
For transfection experiments, mouse BMMs seeded in 6-well plates were pre-treated with 25 ng/mL M-CSF for 2 days. They were then transfected with gal-3 or negative control (NC) siRNA for 1 d according to the supplier’s protocol (sc-35443, 36869, Santa Cruz Biotechnology, Santa Cruz, CA, USA) in the presence of 25 ng/mL M-CSF. The end of transfection was regarded as time zero. At this point, 50 ng/mL RANKL was added to 25 ng/mL M-CSF to induce OC formation in each group. The cells were divided into four groups as follows (Figure 11): NC siRNA + anhydrous alcohol (solvent), NC siRNA + 1α,25-(OH)2D3, gal-3 siRNA + anhydrous alcohol, and gal-3 siRNA + 1α,25-(OH)2D3. The medium was changed every 2 days.
Figure 11. Timeline of cell transfection and the treatment with 1α,25-(OH)2D3. The black solid line represents M-CSF, the blue solid line represents M-CSF+NC siRNA, the blue dashed line represents M-CSF+gal-3 siRNA, the red solid line represents M-CSF+RANKL, and the red dashed line represents M-CSF+RANKL+1α,25-(OH)2D3.
According to previously reported methods [45][46], 25 ng/L M-CSF and 50 ng/L RANKL were used to induce OC formation. TRAP staining and bone resorption were observed to identify OC formation. OCPs were cultured in α-MEM supplemented with 10% FBS, 25 ng/mL M-CSF, and 50 ng/mL RANKL for 6 days. The cells were fixed in 4% paraformaldehyde solution for 10 min and washed with phosphate-buffered saline (PBS). They were then stained using the TRAP Staining Kit (Sigma-Aldrich) following the manufacturer’s instructions. Cells with more than three nuclei and wine-colored granules in the cytoplasm were regarded as OCs. For bone resorption, PBS was used to repeatedly wash the plates to remove the adherent cells from Corning Osteoassay Surface Multiple Well Plates (Corning, NY, USA). Images were obtained using an inverted microscope (Leica, Wetzlar, Hessen, Germany). Image-Pro Plus (JEDA Science Technology Development, Nanjing, China) was used to calculate the bone resorption pit area.
According to our previously described methods [46], OCs were lysed on ice for 30 min using radio immunoprecipitation assay (RIPA) lysis buffer (Applygen, Beijing, China) with protease inhibitor (Beyotime, Shanghai, China). The protein concentration in each sample was measured using the BCA Protein Assay Kit (Beyotime) and normalized. Proteins were separated by SDS-PAGE (NCM Biotech, Suzhou, China) and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). Then, the PVDF membranes were blocked with 5% bovine serum albumin (BSA) (Sigma-Aldrich) at room temperature for 2 h and incubated with anti-gal-3 (Proteintech, Rosemont, IL, USA), anti-NFATc1 (Santa Cruz Biotechnology), anti-MMP-9 (Abcam, Boston, MA, USA), anti-GAPDH, and anti-β-actin (CST, Danvers, MA, USA) antibodies overnight at 4 °C. Secondary antibodies with horseradish peroxidase (Jackson Laboratories, Bar Harbor, ME, USA) were added to the PVDF, which was washed with Tris-buffered saline and Tween (TBST). Proteins were visualized using a Tanon 5200 Electrochemiluminescence (ECL) Detection System (Tanon, Shanghai, China). ImageJ (National Institute of Mental Health, Bethesda, MD, USA) was used to analyze protein expression levels.
RNA was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using HiScript QRT SuperMix (Vazyme, Nanjing, China), and then qPCR was conducted using ChamQ SYBR qPCR Master Mix (Vazyme) according to the manufacturer's instructions. Primer sequences were designed based on Ctsk, MMP-9, Lgals3, and Gapdh gene sequences searched from NCBI of mouse and are shown in Table 1. Gapdh expression was used as an internal control. The cycle reaction was set at 95 °C for 10 s and 60 °C for 30 s for 40 cycles.
Table 1. Sequences of PCR primers used in this study.
Genes |
Sequences |
|
Lgals3 |
Forward (5′-3′) |
GTACAGCTAGCGGAGCGG |
Reverse(5′-3′) |
CGGATATCCTTGAGGGTTTG |
|
Ctsk |
Forward (5′-3′) |
CGCCTGCGGCATTACCAA |
Reverse(5′-3′) |
TAGCATCGCTGCGTCCCT |
|
Mmp-9 |
Forward (5′-3′) |
GCCCTGGAACTCACACGACA |
Reverse(5′-3′) |
TTGGAAACTCACACGCCAGAAG |
|
Gapdh |
Forward (5′-3′) |
AAATGGTGAAGGTCGGTGTG |
Reverse(5′-3′) |
TGAAGGGGTCGTTGATGG |
Co-immunoprecipitation studies were performed using previously described methods, with slight modifications [47]. Extracts of about 200 μg of protein per sample were precleared with protein A/G beads and then mixed with 2 μg of VDR antibody or control non-immune rabbit Ig immobilized on protein A/G beads in an“immunoprecipitation buffer” supplemented with protease inhibitors. The reactions were then incubated overnight at 4 °C. After being washed three times with 0.1% PBS-Tween, proteins degenerated by SDS buffer were resolved by SDS-PAGE and transferred onto PVDF membranes. The Western blotting was then probed with antibodies against gal-3 at 4 °C overnight.
OCs cultured on sterile coverslips were washed with PBS. They were fixed with a 4% paraformaldehyde solution. Triton X-100 (0.5%, Amresco, Solon, OH, USA) was used for membrane permeabilization at room temperature. Cells were blocked with 5% BSA and incubated with anti-gal-3 and anti-VDR antibodies overnight at 4 °C. An IgG negative control was set. Phalloidin-iFluor 555 Reagent (Abcam) was used to detect F-actin, and nuclei were visualized with DAPI (Beyotime) according to the manufacturer’s instructions. Imaging was performed using a fluorescence microscope (Leica DMI3000B; Wetzlar). Immunofluorescent co-located figures were analyzed by Leica software, and a line segment from the top left to the bottom right. The point in the upper left is the origin, the x-axis represents the distance from the origin, and the y-axis represents the intensity of fluorescence. The green line across OCs which fluorescence intensity presented in the Figure 6B first figure, and the yellow line across OCPs which fluorescence intensity presents in the Figure 6B second figure. The red curve represents VDR, the green curve represents gal-3, and the blue curve represents the nucleus.
Statistical analysis of all data was performed using GraphPad Prism 7 (GraphPad Software). Each experiment was repeated at least three times in vitro. Statistical significance was defined as p < 0.05.
In our study, we confirmed the regulatory effects of the 1α,25-(OH)2D3/VDR/gal-3 axis on the osteoclastogenesis potential of BMMs. OC formation and activation induced by RANKL via gal-3 was inhibited by 1α,25-(OH)2D3, which is a negative regulator of OC formation and activation. Figure 12 provides a visual overview of the detailed mechanism underlying OC formation and activation revealed in our study.

Figure 12. Schematic diagram of the role of gal-3 in OC formation and activation regulated by 1α,25-(OH)2D3. Briefly, 1α,25-(OH)2D3 inhibited OC formation and activation induced by RANKL and increased gal-3 expression. Gal-3, a negative regulator of OC formation and activation, colocalized with VDR and contributed to the inhibitory effect of 1α,25-(OH)2D3 on OC formation and activation.
This entry is adapted from the peer-reviewed paper https://doi.org/10.3390/ijms222413334