You're using an outdated browser. Please upgrade to a modern browser for the best experience.
Sulfotransferase (SOT) Gene Family in Potato (Solanum tuberosum): Comparison
Please note this is a comparison between Version 1 by Parviz Heidari and Version 2 by Vivi Li.

Various kinds of primary metabolisms in plants are modulated through sulfate metabolism, and sulfotransferases (SOTs), which are engaged in sulfur metabolism, catalyze sulfonation reactions. In this study, a genome-wide approach was utilized for the recognition and characterization of SOT family genes in the significant nutritional crop potato (Solanum tuberosum L.). Twenty-nine putative StSOT genes were identified in the potato genome and were mapped onto the nine S. tuberosum chromosomes. The protein motifs structure revealed two highly conserved 5′-phosphosulfate-binding (5′ PSB) regions and a 3′-phosphate-binding (3′ PB) motif that are essential for sulfotransferase activities. The protein–protein interaction networks also revealed an interesting interaction between SOTs and other proteins, such as PRTase, APS-kinase, protein phosphatase, and APRs, involved in sulfur compound biosynthesis and the regulation of flavonoid and brassinosteroid metabolic processes. This suggests the importance of sulfotransferases for proper potato growth and development and stress responses. Notably, homology modeling of StSOT proteins and docking analysis of their ligand-binding sites revealed the presence of proline, glycine, serine, and lysine in their active sites. An expression essay of StSOT genes via potato RNA-Seq data suggested engagement of these gene family members in plants’ growth and extension and responses to various hormones and biotic or abiotic stimuli. Our predictions may be informative for the functional characterization of the SOT genes in potato and other nutritional crops.

  • sulfur
  • sulfotransferase
  • potato
  • bioinformatics
  • protein structure
  • stimuli coping

1. Introduction

The chemical element sulfur (S) is a necessary factor for life found in the amino acid cysteine (Cys) and methionine (Met), certain vitamins (e.g., thiamin and biotin), co-enzymes (e.g., S-adenosyl methionine), iron–sulfur complexes, prosthetic substances, glutathione (GSH) antioxidants, and others natural secondary metabolites [1]. The adequate S in the soil helps plant growth and development, and it is helpful to get a high plant yield of high quality [2]. Moreover, the deficiency of S makes plants susceptible to various biotic and abiotic stresses [3]. An S content ≤ 0.25% in any plant tissue may be considered severe S deficiency; plants with such deficiency have overall chlorosis and yellowish color due to lack of chlorophyll in the early stage of development [4].
Sulfotransferases (SOTs) (EC 2.8.2.-) are sulfate-regulating proteins in various organisms. In plants, the conjugate reaction of sulfate play a vital role in plant growth and development and in response to various stresses [5]. Sulfate is activated by two subsequent steps for the formation of adenosine-5′-phosphosulfate (APS) and 3′-phosphoadenosine-5′-phosphosulfate (PAPS) before being involved in further biochemical reactions [6]. Sulfotransferases (SOTs) (EC 2.8.2.-) catalyze the transfer of a sulfate group from PAPS to a hydroxyl group of different substrates [7]. Sulfated substances in plants function as secondary metabolites, hormones in coping with stimulus situations, and use as important S storage substances during the life cycle [8]. Plant SOTs are directly engaged in the sulfation process of desulpho-glucosinolate compounds (ds-Gl), which are important secondary metabolites that provide resistance against multiple biotic/abiotic stimuli in brassicales plants [9]. All SOT proteins can be identified by a histidine residue in their PAPS-binding region and by a specific SOT domain (Pfam: PF00685) [10]. SOT family members are specified by four conserved regions (I to IV) in their protein sequences [11], in which the I and IV regions are highly conserved sections [8]. Three AtSOT16AtSOT17, and AtSOT18 genes in the Arabidopsis thaliana (At) genome are responsible for transferring a sulfuryl group to various ds-Gl compounds [8][12][8,12]. Various substances, such as brassinosteroids, gibberellic acids, glucosinolates, flavonoids, coumarins, and phenolic acids, can be sulfated by SOT proteins in various plant species [13][14][13,14].
Multiple studies indicate that SOT genes can regulate plant stimuli responses, stress sensing and signaling mechanisms, and developmental processes. For example, in rice, Oryza sativa, expression of some SOT gene was observed in root, stigma, and ovary tissues in response to indole acetic acid and Benzyl aminopurine [15]BrSOT16 in Brassica rapa indicated strong expression in all tissues except for stamen [16]ds-Gl AtSOTs, such as AtSOT15, is responsible for circadian control [13]; and expression levels of 11 OsSOTs exhibited some up- and downregulation in response to dehydration, high or low temperatures, and hormone stresses in various tissues [15]. Northern blotting of AtSOT12 revealed that the deduced protein employs flavonoids, brassinosteroids, and salicylic acid compounds as substrates; may be expressed in leaves, flowers, and roots; and responds to abiotic stimuli (such as salt, sorbitol, and cold), hormones, and interactions with biotic pathogens [17][18][17,18]. Studies on homologous genes from B. napus revealed increased BNST3 and BNST4 transcripts during exposure to hormones, low oxygen, xenobiotics, and herbicides [14][19][14,19]. This provides evidence for the role of these genes in stress responses and detoxification. Some experimental evidence suggests that SOT may also act as a tyrosyl protein and may involve in phytosulphokines biosynthesis [8]. The glucosinolate and their degradation products provide a defense to plant against insects and fungi. Some evidence shows the role of sulphotransferases in the biosynthesis of glucosinolate. Hence, further exploration of SOT can provide important information for the control of pests [8].
The importance of S during the plant life cycle and associated biological and chemical processes is helpful to overcome S shortage for crop production and improvement. Potato is considered an important food crop after wheat, maize, and rice. Adequate S content in potato plants facilitates the uptake of multiple nutrients, carbohydrate formation, vitamin synthesis, chlorophyll production, seed development and stress, and pest resistance [3][20][3,20]. Defective S contents lead to upward curving of potato leaves, along with light-green-to-yellow color. Hence, this leads to poor plant growth, prolate form, and postponed maturity [21]. Previous studies have shown that sufficient S elevated the yield of potato tubers and quality and increased tolerance against various pathogens through the sulfur-induced resistance (SIR) mechanism [3], whereas insufficient S lead to a reduction of several important compounds. [22]. These important aspects necessitate the understanding of plant S biology and adjustment of S nutrition in agricultural programs. Therefore, the identification of important sulfotransferases in the S metabolism may elucidate the S-mediated proper growth and resistance mechanisms in potato. SOTs have been identified in Arabidopsis (22 members) [8], rice (35 members) [15], and B. rapa (56 members) [16]. However, the identification and characterization of SOT proteins in the potato (Solanum tuberosum) genome are currently limited. In the current study, various bioinformatics approaches have been utilized to distinguish important cluster SOTs and their expression patterns in multiple tissues and during different biotic or abiotic stimuli. Our predictions may assist functional evaluation of the SOT gene family members in potato and related crop species.

2. Identification of StSOT Genes

The deduced amino acid sequence of sulfotransferase domain (PF00685) was searched against the Hidden Markov Model (HMM) program and Phytozome database. This led to the identification of 29 putative StSOT proteins; all contained the Sulfotransfer_1 domain and were named according to their chromosomal order (Table 1).
Table 1. Identified StSOT gene family members and their characteristics in the potato genome.
Gene ID Gene Symbol Protein Length (aa) MW (KDa) Isoelectric Point Subcellular Localization
). A remarkable proportion of residues in each protein model was included in the lowest energy regions, indicating decreasing energies in various parts of these putative StSOT proteins.
Figure 8. Three-dimensional docking analysis of StSOT protein ligand-binding sites. The binding residues, metallic heterogeneous and non-metallic heterogeneous are shown in blue spacefill, green spacefill, and colorful wireframe, respectively.
Table 4. Properties of secondary and tertiary structures of StSOT proteins, validation, and channel numbers.
Protein Name α-Helixes (%) β-Sheets (%) Coils (%) Turns (%) Channel Number Ramachandran Plot (%) z-Values
PGSC0003DMG400000144 StSOT01 296 34.38 6.54 Nuclear, Cyt., Extra.
PGSC0003DMG400027779 StSOT02 345 40.01 7.12 Cyt.
PGSC0003DMG400003287 StSOT03 337 38.80 5.73 Cyt.
PGSC0003DMG400031776 StSOT04 344 40.10 5.4 Cyt.
PGSC0003DMG400024622 StSOT05 350 40.15 6.54 Cyt.
PGSC0003DMG400018798 StSOT06 326 37.56 5.62 Cyt.
PGSC0003DMG400026753 StSOT07 101 11.83 5.74 Nuclear, Cyt.
PGSC0003DMG400026752 StSOT08 101 11.98 7.68 Nuclear, Cyt.
12.10
8.99
Cyt., Mitochondrial, Nuclear
Cyt., cytoplasm; Extra., extracellular.
The identified StSOT proteins had diverse lengths, ranging from 101 aa (StSOT07 and StSOT08) to 359 aa (StSOT21). Molecular weights (MWs) ranged from 11.83 kDa (StSOT07) to 41.56 kDa (StSOT21). Most of the identified StSOT proteins (approximately 65.5%) were of acidic nature (theoretical pI ≤ 7.0), ranging from 4.95 (cytosolic StSOT28) to 6.83 (cytosolic StSOT13). The subcellular location of proteins indicated that most of StSOTs (approximately 76%) can be considered as cytoplasmic proteins with no putative transmembrane domains (TMDs). StSOT07, StSOT08, and StSOT28 were predicted to be located in the nucleus in addition to the cytoplasm (Table 1). The proteins StSOT01 and StSOT22 were also predicted to be localized in the nucleus and extracellular region. Two StSOT proteins, namely StSOT23 and StSOT29, could also be found in the mitochondria. Not all StSOT proteins contained any putative TMDs in both cytosolic N- and C-terminal regions that can suggest their specific function during the other cellular pathways apart from membrane transport. The StSOT proteins’ post-translational phosphorylation analysis illustrated a wide variety of phosphorylated serine (S) residues, along with some changed threonine (T) and tyrosine (Y) sites (Figure 1 and Supplementary Materials Table S1, supplementary could be found in https://www.mdpi.com/2223-7747/10/12/2597#supplementary). The proteins StSOT02, StSOT05, StSOT07, StSOT08, and StSOT28 were predicted to contain a limited amount of phosphorylated regions (in one or two residues) in their amino acid sequences, while some StSOTs, such as StSOT01, StSOT04, StSOT06, StSOT12, StSOT14, StSOT22, and StSOT26, were predicted as the possible highly phosphorylated sulfotransferase proteins in potato.
Figure 1. Phosphorylation prediction with scores ≥ 0.95 in StSOT proteins based on serine, threonine, and tyrosine, using NetPhos 3.1 server.

3. Phylogenetic Relationships, Conserved Motifs/Residues, and Gene Structure of StSOTs

The sulfotransferase proteins from potato, Arabidopsis, tomato, and Sorghum were used to generate a phylogenetic tree to classify the SOT proteins into subfamilies (Figure 2). The phylogenetic tree clustered SOTs into the four main groups according to the tree topology and classification of the sulfotransferases in Arabidopsis. Four SOTs of tomato along StSOT09 were classified in group I and showed a high genetic distance. Six StSOTs and five SOTs of tomato were located in group II, and all sorghum SOT proteins were grouped with StSOT01, StSOT02, StSOT04, StSOT05, and StSOT25 from potato and AtSOT16, AtSOT17 and AtSOT18 from Arabidopsis and four tomato SOTs in group III. Interestingly, all sorghum SOT proteins were separated from dicot SOTs. Group IV was the largest group, and most SOTs of potato, Arabidopsis, and tomato were located in this group (Figure 2).
Figure 2. Phylogenetic relationships of SOT proteins from potato, tomato, Arabidopsis, and sorghum. The four main clusters were detected based on the ML method in the phylogenetic tree. Abbreviations: St, potato; Solyc, tomato; Sobic, sorghum; At, Arabidopsis.
Eight conserved motifs were predicted in the StSOT protein sequences via the MEME program (Figure 3a and Supplementary Materials Table S2). The StSOT proteins belonging to the same phylogenetic group shared an approximately similar conserved motif composition. Five out of the eight predicted motifs, namely motif 1, motif 2, motif 3, motif 4, and motif 6, were identified as having a Sulfotransfer_1 domain (Supplementary Materials Table S2). Motif 1 and motif 6 possessed the critical N-terminal PSB loop and C-terminal PB region, respectively, which are critical for the sulfotransferase activity of SOT proteins (Supplementary Materials Figure S1). The sequences related to these two important motifs are significantly conserved; this high conservation can be found in both cytosolic and membrane sulfotransferases (Supplementary Materials Figure S1).
Figure 3. Conserved motifs predicted in the StSOT protein sequences (a). Exon–intron structure predicted in the StSOT family genes (b). Two important functional 5′ PSB and 3′ PB regions were detected in the motif 1 and motif 6, respectively.
The N-terminal region 5′ PSB in motif 1 is related to the PSB-loop and helix 3 sections in the sulfotransferase protein structure that encompasses five successive residues engaged in an interaction with the PAPS compound 5′-phosphate region. In this study, the amino acid residues in this motif that are engaged in sulfotransferase catalytic activity include completely conserved Lys-103 and relatively conserved Thr-106 that can be substituted by the functionally similar residues Ser and Cys (Figure 3a and Supplementary Materials Figure S1). Our results revealed that genes within each subfamily have significant similarities in exon and intron numbers. For example, all StSOT genes had an intronless structure except for StSOT18StSOT19StSOT23, and StSOT24, which contained two exons and one intron and were classified into the phylogenetic group II (Figure 3b).

4. Genomic Distribution, Duplication Assay, and Synteny Relationships of StSOT Genes

All StSOT gene family members were successfully mapped onto 9 out of 12 chromosomes in the potato genome. The chromosomal map revealed an unequal distribution of the gene family members throughout the chromosomes (Figure 4). Chromosome 5 harbored the largest number of StSOTs (13 genes), while only one StSOT each was predicted to be localized on chromosomes 2, 4, 6, and 9. Nine segmentally duplicated gene pairs categorized into five groups (including duplication and triplication events) were recognized in the StSOT gene family. These groups are indicated with different colors in Figure 4, revealing paralogous pairs. The highest numbers of duplicated/triplicated genes were distributed on chromosome 5, with three duplications and three triplications clustered into the four gene groups (Table 2).
Figure 4. Chromosomal map of StSOT family genes in the potato genome. Five series of duplicated/triplicated StSOTs are indicated in different colors. The scale is in mega bases.
Table 2. Duplicated gene pairs in the StSOT gene family and Ka/Ks analysis. Multiple duplication/triplication events were identified in five categories (in different colors in the chromosomal map in Figure 4).
Duplicated Gene Pairs Duplication Type Ka Ks Ka/Ks Date (Million Years Ago) a
1 StSOT07-StSOT08 Segmental 0.0213 0.075 0.284 5.769
StSOT01 132 (44%) 50 (16%) 114 (38%) 76 (25%) 7 93.50% −8.4
2 StSOT10-StSOT13 Segmental 0.003 0.006 0.448 0.461
StSOT02 161 (46%) 41 (11%) 143 (41%) 92 (26%) 9 93.90% −8.73 StSOT10-StSOT13-StSOT15 0.010 0.042 0.244 3.230
StSOT03 141 (41%) 50 (14%) 146 (43%) 84 (24%) 8 90.10% 3 StSOT26-StSOT27 Segmental 0.014 0.057 0.254 4.384
−8.15 StSOT14-StSOT26-StSOT27 0.010 0.033
StSOT04 148 (43%)0.317 2.538
46 (13%) 4 StSOT16-StSOT22 Segmental 0.015 0.063 0.252 4.846
5 StSOT19-StSOT20 Segmental 0.016 0.029 0.544 2.230
StSOT18-StSOT19-StSOT20 0.010 0.045 0.228 3.461 PGSC0003DMG400039363 StSOT09 313 36.15 6.27 Cyt.
StSOT19- StSOT20-StSOT29 0.006 0.024 0.275 1.846 PGSC0003DMG400005584 StSOT10 330 38.49 6.6 Cyt.
PGSC0003DMG400028349 StSOT11 335 39.05 6.8 Cyt.
150 (43%) 88 (25%) 7 93.90% −8.15 PGSC0003DMG400028301 StSOT12 335 39.17 7.11 Cyt.
PGSC0003DMG400025717 StSOT13 308 35.90 6.83 Cyt.
PGSC0003DMG400036271 StSOT14 329 38.38 6.42 Cyt.
PGSC0003DMG400046427 StSOT15 330 38.58 7.13 Cyt.
PGSC0003DMG400028302 StSOT16 332 38.66 6.72 Cyt.
PGSC0003DMG400028350 StSOT17 240 28.31 6.31 Cyt.
PGSC0003DMG400015051 StSOT18 269 31.41 7.71 Cyt.
PGSC0003DMG400028341 StSOT19 268 31.24 7.72 Cyt.
PGSC0003DMG403028340 StSOT20 209 24.68 7.67 Cyt.
PGSC0003DMG400002358 StSOT21 359 41.56 7.03 Cyt.
PGSC0003DMG400014962 StSOT22 226 26.06 6.59 Nuclear, Extra.
PGSC0003DMG400029882 StSOT23 118 13.63 6.5 Cyt., Mitochondrial
PGSC0003DMG400020968 StSOT24 316 36.90 7.16 Cyt.
PGSC0003DMG400039919 StSOT25 244 28.49 5.51 Cyt.
PGSC0003DMG400046295 StSOT26 329 38.25 5.83 Cyt.
PGSC0003DMG400046521 StSOT27 161 19.20 5.76 Cyt.
PGSC0003DMG400014947 StSOT28 105 12.24 4.95 Cyt., Nuclear
PGSC0003DMG400009660 StSOT29 106
a Duplication and divergence time (million years ago) were computed based on the T= [Ks/2λ (λ = 6.5 × 10−9)] × 10−6 formula.
Intraspecies synteny results revealed that many of the duplicated blocks were collinear, such as StSOT07StSOT08 and StSOT26StSOT27. The Ka/Ks magnitudes related to the paralogous pairs ranged from 0.228 to 0.448. According to these ratios, the duplication events were estimated to have occurred between 0.461 to 5.769 million years ago (MYA). The Ka/Ks ratios < 1 in duplicated gene pairs from StSOT family in potato suggested that these genes have been impressed by purifying selection (Table 2). Synteny analysis has also been performed across the potato and some related plant genomes, which can determine the probable functions of the potato StSOT genes (Figure 5). According to the results, all StSOT genes showed synteny relationships with their orthologs in the tomato (approximately 35%) and Arabidopsis (approximately 32%) genomes. The maximum orthology percentage of the StSOT on the potato genome was revealed with tomato. These wide synteny relations at the gene level were considered as confirmation for their close evolutionary relationships. These findings demonstrated the vast rearrangement events of potato chromosomes during the genome evolution process.
Figure 5. Synteny relationships of StSOT genes with orthologs from (a) tomato and (bArabidopsis.

5. Identification of Cis-Regulatory Elements in StSOT Promoters

In the present study, the StSOT promoter regions in the potato genome were investigated to identify the putative cis-regulatory elements. Several kinds of cis-elements for responses to various phytohormones and abiotic stimulus conditions were identified (Supplementary Materials Table S3). The promoter common cis-elements, such as the core element TATA-box, CAAT-box, and circadian control element, were identified in all StSOT genes. The ABRE (abscisic acid responsiveness), ERE (ethylene responsiveness), and MeJA (Methyl jasmonate responsiveness) factors were predicted as frequently encountered hormone-responding cis-elements in most StSOT promoters. The light-responsive G-Box and Box 4, wounding-stress-responsive WUN-motif, anaerobic inducible ARE, and stress-responsive MYB elements were identified as the other regulatory cis-elements frequently occurring in the StSOT promoter areas, suggesting important roles of this gene family in stress responses. The TC-rich repeats (regulating defensive reactions), LTR (low-temperature responsive), TCA-element (salicylic acid-responsive), TGA-element (auxin-responsive), and W-Box (WRKY transcription factors binding region, important for abiotic stimuli responses) were identified as abiotic and hormone-stress-responsive elements predicted in StSOT08StSOT11StSOT13StSOT16StSOT22, and StSOT26. Multiple regulatory cis-elements related to phytohormones and environmental stimuli were identified in most StSOT genes, suggesting the critical roles of these genes in potato growth and responses to stress conditions.

6. Predicted miRNAs for StSOT Genes

Six StSOT transcripts were predicted to be regulated by various miRNAs. For example, the transcripts StSOT06StSOT17StSOT20, and StSOT21 were targeted by stu-miR8029, stu-miR8043, stu-miR8040-3p, and stu-miR8051-3p, respectively (Table 3). Interestingly, four miRNAs, including stu-miR7993a-d, were predicted to target both StSOT11 and StSOT15 for inhibition of translation (Table 3 and Figure 6). Furthermore, the targeted regions of StSOTs by these miRNAs were predicted into the Sulfotransfer_1 domain region, indicating that the StSOT genes are regulated by the identified miRNAs. Remarkably, the identified miRNAs targeted the StSOT genes in group IV, illustrating important similarities in their cellular functions during potato growth, development, and degradation. Moreover, targeting of StSOT genes by various miRNA isoforms may indicate an important role of these genes during various cellular processes in addition to S assimilation activity.
Figure 6. Interaction network between micro-RNAs and StSOT genes.
Table 3. Predicted miRNA-targeted StSOT transcripts in the potato genome.
miRNA Accession Target Gene miRNA Aligned Fragment Inhibition Type
stu-miR8029 StSOT06 CGAGGUUUUGUUUCUUUUUACCGA Translation
stu-miR7993a StSOT11 UCAAUUCAAUUGGUGUAUUUUAUA Translation
stu-miR7993b-3p StSOT11 UCAAUUCAAUUGGUGUAUUUUAUA Translation
stu-miR7993c StSOT11 UCAAUUCAAUUGGUGUAUUUUAUA Translation
stu-miR7993d StSOT11 UCAAUUCAAUUGGUGUAUUUUAUA Translation
stu-miR7993d StSOT15
StSOT05 142 (40%) 39 (11%) 169 (48%) 68 (19%) 12 92.80% −8.61 UCAAUUCAAUUGGUGUAUUUUAUA Translation
StSOT06 152 (46%) 39 (11%) 135 (41%) 80 (24%) 12 94.10% −8.16 stu-miR7993c StSOT15
StSOT07UCAAUUCAAUUGGUGUAUUUUAUA Translation
47 (46%) 0 (0%) 54 (53%) 32 (31%) 5 90.90% −1.85 stu-miR7993a StSOT15 UCAAUUCAAUUGGUGUAUUUUAUA
StSOT08Translation
50 (49%) 3 (2%) 48 (47%) 20 (19%) 4 92.90% −2.01 stu-miR7993b-3p StSOT15 UCAAUUCAAUUGGUGUAUUUUAUA Translation
StSOT09 148 (47%) 44 (14%) 121 (38%) 76 (24%) 10 93.20% −8.71 stu-miR8040-3p StSOT20 CUAGUAUUAAUGUUAAUAUUC Cleavage
StSOT10 151 (45%) 47 (14%) 132 (40%) 72 (21%) 10 94.20% −8.45 stu-miR8043 StSOT17 CCGGUUUCAGGUUAAUAUAGU Cleavage
stu-miR8051-3p StSOT21 UUAUCAUACCAUCUUCUUUAU Cleavage

7. Protein–Protein Interactions

The interactome data revealed that SOT proteins interact with proteins involved in transmembrane transport, heme binding, iron–sulfur cluster binding, and transition of phosphate groups (Figure 7 and Supplementary Materials Table S4). SOT16, SOT17, and SOT18, which regulate S compounds and secondary metabolite biosynthetic processes, were likely part of an interaction network with a glucosyltransferase protein that contains transmembrane transporter activity and may respond to stimuli through ion homeostasis. APS (pseudouridine synthase/archaeosine transglycosylase-like family protein), APR (Adenine phosphoribosyl reductase), APK (Adenylyl-sulfate kinase), and MET3-1 precorrin methyl transferase were identified as other transferases working with StSOTs in the biosynthesis of S compounds and secondary metabolites (Supplementary Materials Table S4), which can mediate potato growth and stimuli resistance. The interaction of StSOTs with adenylyl-sulfate kinases can control sulfate assimilation and regulation of S-containing amino acid metabolic processes that are essential for plant reproduction and viability. The APR proteins in the network with StSOTs can adjust iron–sulfur complexes and reduce sulfate for Cys biosynthesis and can be induced by sulfate starvation. The annotation of the SUR, CYP, and AKN proteins that interact with StSOTs revealed the involvement of these interactions in secondary metabolite biosynthetic processes and sulfate assimilation, which modulate plant growth and development and responses to diverse stimuli. The SIR protein was also predicted to be engaged in metal ion transition and secondary metabolite biosynthetic processes that can regulate potato cellular response to stress and sulfate starvation (Supplementary Materials Table S4).
Figure 7. Protein–protein interaction network of SOT proteins, using Arabidopsis interactome data through STRING server v11, and improved by using Cytoscape.

8. Predicted 3D Modeling, Binding Sites, and Validation of StSOT Proteins

The 3D models of StSOT proteins were prepared through the Phyre2 program, under >90% confidence, according to the templates 5mek (as a cytosolic sulfotransferase) and 1q44 and 1fmj (as the P-loop containing PAPS sulfotransferases in Arabidopsis). The 3D structure of StSOTs exhibited the conserved typical frames consisting of β3-α8 (as the PSB loop in the proteins 5′ region) and β8-α6 (as the 3′PB motif) (Figure 8 and Supplementary Materials Figure S2). In the model validation, the Ramachandran plot analysis revealed that the qualities of the StSOT protein models varied from 80% to 95%, suggesting the good quality of the predicted 3D models and reliability (Table 4). For further verification, the ProSA server was utilized for evaluation of probable errors within the protein models, indicating the existence of negative z-values in a conformation zone for the predicted models, which can be experimentally distinguished through both X-ray and NMR spectroscopy (Table 4
StSOT11
140 (41%)
40 (11%)
155 (46%)
84 (25%)
11 94.00% −8.52
StSOT12 146 (43%) 42 (12%) 147 (43%) 84 (25%) 12 92.50% −8.66
StSOT13 120 (38%) 36 (11%) 152 (49%) 96 (31%) 13 81.70% −7.64
StSOT14 145 (44%) 46 (13%) 138 (41%) 80 (24%) 5 94.50% −8.6
StSOT15 152 (46%) 50 (15%) 128 (38%) 88 (26%) 3 95.10% −7.93
StSOT16 148 (44%) 42 (12%) 142 (42%) 76 (22%) 12 91.50% −9.05
StSOT17 115 (47%) 20 (8%) 105 (43%) 64 (26%) 12 95.40% −6.17
StSOT18 128 (47%) 30 (11%) 111 (41%) 44 (16%) 7 93.60% −7.99
StSOT19 132 (49%) 31 (11%) 105 (39%) 64 (23%) 11 95.90% −7.92
StSOT20 103 (49%) 12 (5%) 94 (44%) 44 (21%) 12 94.20% −6.67
StSOT21 143 (39%) 43 (11%) 173 (48%) 76 (21%) 10 91.30% −7.93
StSOT22 94 (41%) 29 (12%) 103 (45%) 72 (31%) 13 79.90% −5.5
StSOT23 37 (31%) 25 (21%) 56 (47%) 36 (30%) 5 92.20% −4.01
StSOT24 146 (46%) 35 (11%) 135 (42%) 68 (21%) 9 89.80% −8.12
StSOT25 113 (46%) 21 (8%) 110 (45%) 60 (24%) 5 93.00% −5.86
StSOT26 154 (46%) 45 (13%) 130 (39%) 96 (29%) 6 93.30% −8.77
StSOT27 83 (51%) 3 (1%) 74 (46%) 32 (20%) 4 94.30% −4.56
StSOT28 49 (46%) 0 (0%) 56 (53%) 24 (22%) 5 80.60% −3.48
StSOT29 49 (46%) 0 (0%) 57 (53%) 24 (22%) 5 94.20% −2.78
The highest numbers of protein channels were predicted in StSOT05, StSOT06, StSOT11, StSOT12, StSOT13, StSOT16, StSOT17, StSOT19, StSOT20, and StSOT22, with channel numbers of 11 to 13 (Table 4). Interestingly, some StSOT proteins with considerable similarity in their channel regions, such as StSOT05–StSOT06 and StSOT10–StSOT21, were also included in the same phylogenetic group. Accordingly, this may suggest that the evolutionary divergence of StSOTs can modulate gene characteristics to function in various molecular pathways.
Various numbers of ligand and ligand-binding amino acid residues were identified in the StSOT protein structures (Supplementary Materials Table S5). Some metallic and non-metallic heterogeneous were predicted in the center of the binding region in all candidate protein models (Figure 8). Ser, Pro, Gly, Lys, Tyr, and Arg were predicted as the binding residues in almost all of the ligand-binding regions in the candidate StSOT proteins, which suggest the importance of these residues in positioning on the DNA molecule and in the performance of cellular functions. The Ca, Zn, and Mg ions were identified as the metallic heterogeneous in the StSOT functional domains. Although some binding residues were predicted to be outside of the specific domain, our docking assay indicated that most of these functional regions were included in the Sulfotransfer_1 domain. The binding residues and their metallic or non-metallic interacting heterogeneous revealed that some variations suggest the functional specificity of StSOT genes, in addition to their common functions under stimuli exposure and responding to variations in cell metabolism.

References

  1. Takahashi, H.; Buchner, P.; Yoshimoto, N.; Hawkesford, M.J.; Shiu, S.-H. Evolutionary relationships and functional diversity of plant sulfate transporters. Front. Plant Sci. 2012, 2, 119. [Google Scholar] [CrossRef] [PubMed]
  2. d’Hooghe, P.; Dubousset, L.; Gallardo, K.; Kopriva, S.; Avice, J.-C.; Trouverie, J. Evidence for proteomic and metabolic adaptations associated with alterations of seed yield and quality in sulfur-limited Brassica napus L. Mol. Cell. Proteom. 2014, 13, 1165–1183. [Google Scholar] [CrossRef] [PubMed]
  3. Klikocka, H.; Haneklaus, S.; Bloem, E.; Schnug, E. Influence of sulfur fertilization on infection of potato tubers with Rhizoctonia solani and Streptomyces scabies. J. Plant Nutr. 2005, 28, 819–833. [Google Scholar] [CrossRef]
  4. Gupta, U.C.; Sanderson, J.B. Effect of sulfur, calcium, and boron on tissue nutrient concentration and potato yield. J. Plant Nutr. 1993, 16, 1013–1023. [Google Scholar] [CrossRef]
  5. Varin, L.; Marsolais, F.; Richard, M.; Rouleau, M. Biochemistry and molecular biology of plant sulfotransferases. FASEB J. 1997, 11, 517–525. [Google Scholar] [CrossRef]
  6. Schmidt, A. Distribution of APS-sulfotransferase activity among higher plants. Plant Sci. Lett. 1975, 5, 407–415. [Google Scholar] [CrossRef]
  7. Glendening, T.M.; Poulton, J.E. Partial Purification and Characterization of a 3′-Phosphoadenosine 5′-Phosphosulfate: Desulfoglucosinolate Sulfotransferase from Cress (Lepidium sativum). Plant Physiol. 1990, 94, 811–818. [Google Scholar] [CrossRef]
  8. Klein, M.; Papenbrock, J. The multi-protein family of Arabidopsis sulphotransferases and their relatives in other plant species. J. Exp. Bot. 2004, 55, 1809–1820. [Google Scholar] [CrossRef]
  9. Rausch, T.; Wachter, A. Sulfur metabolism: A versatile platform for launching defence operations. Trends Plant Sci. 2005, 10, 503–509. [Google Scholar] [CrossRef]
  10. Finn, R.D.; Bateman, A.; Clements, J.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Heger, A.; Hetherington, K.; Holm, L.; Mistry, J. Pfam: The protein families database. Nucleic Acids Res. 2014, 42, D222–D230. [Google Scholar] [CrossRef]
  11. Varin, L.; DeLuca, V.; Ibrahim, R.K.; Brisson, N. Molecular characterization of two plant flavonol sulfotransferases. Proc. Natl. Acad. Sci. USA 1992, 89, 1286–1290. [Google Scholar] [CrossRef] [PubMed]
  12. Klein, M.; Reichelt, M.; Gershenzon, J.; Papenbrock, J. The three desulfoglucosinolate sulfotransferase proteins in Arabidopsis have different substrate specificities and are differentially expressed. FEBS J. 2006, 273, 122–136. [Google Scholar] [CrossRef] [PubMed]
  13. Komori, R.; Amano, Y.; Ogawa-Ohnishi, M.; Matsubayashi, Y. Identification of tyrosylprotein sulfotransferase in Arabidopsis. Proc. Natl. Acad. Sci. USA 2009, 106, 15067–15072. [Google Scholar] [CrossRef] [PubMed]
  14. Marsolais, F.; Sebastià, C.H.; Rousseau, A.; Varin, L. Molecular and biochemical characterization of BNST4, an ethanol-inducible steroid sulfotransferase from Brassica napus, and regulation of BNST genes by chemical stress and during development. Plant Sci. 2004, 166, 1359–1370. [Google Scholar] [CrossRef]
  15. Chen, R.; Jiang, Y.; Dong, J.; Zhang, X.; Xiao, H.; Xu, Z.; Gao, X. Genome-wide analysis and environmental response profiling of SOT family genes in rice (Oryza sativa). Genes Genom. 2012, 34, 549–560. [Google Scholar] [CrossRef]
  16. Zang, Y.; Kim, H.U.; Kim, J.A.; Lim, M.; Jin, M.; Lee, S.C.; Kwon, S.; Lee, S.; Hong, J.K.; Park, T. Genome-wide identification of glucosinolate synthesis genes in Brassica rapa. FEBS J. 2009, 276, 3559–3574. [Google Scholar] [CrossRef]
  17. Baek, D.; Pathange, P.; CHUNG, J.; Jiang, J.; Gao, L.; Oikawa, A.; Hirai, M.Y.; Saito, K.; Pare, P.W.; Shi, H. A stress-inducible sulphotransferase sulphonates salicylic acid and confers pathogen resistance in Arabidopsis. Plant Cell Environ. 2010, 33, 1383–1392. [Google Scholar] [CrossRef]
  18. Lacomme, C.; Roby, D. Molecular cloning of a sulfotransferase in Arabidopsis thaliana and regulation during development and in response to infection with pathogenic bacteria. Plant Mol. Biol. 1996, 30, 995–1008. [Google Scholar] [CrossRef]
  19. Rouleau, M.; Marsolais, F.; Richard, M.; Nicolle, L.; Voigt, B.; Adam, G.; Varin, L. Inactivation of brassinosteroid biological activity by a salicylate-inducible steroid sulfotransferase from Brassica napus. J. Biol. Chem. 1999, 274, 20925–20930. [Google Scholar] [CrossRef]
  20. Bednarek, P. Sulfur-containing secondary metabolites from Arabidopsis thaliana and other Brassicaceae with function in plant immunity. ChemBioChem 2012, 13, 1846. [Google Scholar] [CrossRef]
  21. Barczak, B.; Nowak, K. Effect of sulphur fertilisation on the content of macroelements and their ionic ratios in potato tubers. J. Elem. 2015, 20, 37–47. [Google Scholar] [CrossRef]
  22. Hopkins, L.; Parmar, S.; Błaszczyk, A.; Hesse, H.; Hoefgen, R.; Hawkesford, M.J. O-acetylserine and the regulation of expression of genes encoding components for sulfate uptake and assimilation in potato. Plant Physiol. 2005, 138, 433–440. [Google Scholar] [CrossRef] [PubMed]
  23. Zhang, S.; Xu, Z.; Sun, H.; Sun, L.; Shaban, M.; Yang, X.; Zhu, L. Genome-wide identification of papain-like cysteine proteases in Gossypium hirsutum and functional characterization in response to Verticillium dahliae. Front. Plant Sci. 2019, 10, 134. [Google Scholar] [CrossRef]
  24. Niño, M.C.; Kang, K.K.; Cho, Y.G. Genome-wide transcriptional response of papain-like cysteine protease-mediated resistance against Xanthomonas oryzae pv. oryzae in rice. Plant Cell Rep. 2020, 39, 457–472. [Google Scholar] [CrossRef]
  25. Ding, Q.; Yang, X.; Pi, Y.; Li, Z.; Xue, J.; Chen, H.; Li, Y.; Wu, H. Genome-wide identification and expression analysis of extensin genes in tomato. Genomics 2020, 112, 4348–4360. [Google Scholar] [CrossRef]
  26. Fan, S.; Zhang, D.; Zhang, L.; Gao, C.; Xin, M.; Tahir, M.M.; Li, Y.; Ma, J.; Han, M. Comprehensive analysis of GASA family members in the Malus domestica genome: Identification, characterization, and their expressions in response to apple flower induction. BMC Genom. 2017, 18, 827. [Google Scholar] [CrossRef] [PubMed]
  27. Faraji, S.; Filiz, E.; Kazemitabar, S.K.; Vannozzi, A.; Palumbo, F.; Barcaccia, G.; Heidari, P. The AP2/ERF Gene Family in Triticum durum: Genome-Wide Identification and Expression Analysis under Drought and Salinity Stresses. Genes 2020, 11, 1464. [Google Scholar] [CrossRef]
  28. Waseem, M.; Ahmad, F.; Habib, S.; Li, Z. Genome-wide identification of the auxin/indole-3-acetic acid (Aux/IAA) gene family in pepper, its characterisation, and comprehensive expression profiling under environmental and phytohormones stress. Sci. Rep. 2018, 8, 12008. [Google Scholar] [CrossRef]
  29. Heidari, P.; Ahmadizadeh, M.; Izanlo, F.; Nussbaumer, T. In silico study of the CESA and CSL gene family in Arabidopsis thaliana and Oryza sativa: Focus on post-translation modifications. Plant Gene 2019, 19, 100189. [Google Scholar] [CrossRef]
  30. Rezaee, S.; Ahmadizadeh, M.; Heidari, P. Genome-wide characterization, expression profiling, and post-transcriptional study of GASA gene family. Gene Rep. 2020, 20, 100795. [Google Scholar] [CrossRef]
  31. Faraji, S.; Hasanzadeh, S.; Heidari, P. Comparative in silico analysis of Phosphate transporter gene family, PHT, in Camelina sativa gemome. Gene Rep. 2021, 101351. [Google Scholar] [CrossRef]
  32. Hell, R.; Dahl, C.; Knaff, D.; Leustek, T. Sulfur Metabolism in Phototrophic Organisms; Springer: Berlin/Heidelberg, Germany, 2008. [Google Scholar]
  33. Klaassen, C.D.; Boles, J.W. The importance of 3′-phosphoadenosine 5′-phosphosulfate (PAPS) in the regulation of sulfation. FASEB J. 1997, 11, 404–418. [Google Scholar] [CrossRef]
  34. Kakuta, Y.; Pedersen, L.G.; Pedersen, L.C.; Negishi, M. Conserved structural motifs in the sulfotransferase family. Trends Biochem. Sci. 1998, 23, 129–130. [Google Scholar] [CrossRef]
  35. Visser, R.G.F.; Bachem, C.W.B.; de Boer, J.M.; Bryan, G.J.; Chakrabati, S.K.; Feingold, S.; Gromadka, R.; van Ham, R.C.H.J.; Huang, S.; Jacobs, J.M.E. Sequencing the potato genome: Outline and first results to come from the elucidation of the sequence of the world’s third most important food crop. Am. J. Potato Res. 2009, 86, 417–429. [Google Scholar] [CrossRef]
  36. Diambra, L.A. Genome sequence and analysis of the tuber crop potato. Nature 2011, 475, 7355. [Google Scholar]
  37. Sheshadri, S.A.; Nishanth, M.J.; Simon, B. Stress-mediated cis-element transcription factor interactions interconnecting primary and specialized metabolism in planta. Front. Plant Sci. 2016, 7, 1725. [Google Scholar] [CrossRef]
  38. Zhang, Z.; Li, J.; Zhao, X.-Q.; Wang, J.; Wong, G.K.-S.; Yu, J. KaKs_Calculator: Calculating Ka and Ks Through Model Selection and Model Averaging. Genom. Proteom. Bioinform. 2006, 4, 259–263. [Google Scholar] [CrossRef]
  39. Abdullah; Faraji, S.; Mehmood, F.; Malik, H.M.T.; Ahmed, I.; Heidari, P.; Poczai, P. The GASA Gene Family in Theobroma cacao: Genome Wide Identification and Expression Analyses. Agronomy 2021, 11, 1425. [Google Scholar] [CrossRef]
  40. Heidari, P.; Faraji, S.; Ahmadizadeh, M.; Ahmar, S.; Mora-Poblete, F. New insights into structure and function of TIFY genes in Zea mays and Solanum lycopersicum: A genome-wide comprehensive analysis. Front. Genet. 2021, 12, 534. [Google Scholar] [CrossRef] [PubMed]
  41. Fujii, S.; Kazama, T.; Yamada, M.; Toriyama, K. Discovery of global genomic re-organization based on comparison of two newly sequenced rice mitochondrial genomes with cytoplasmic male sterility-related genes. BMC Genom. 2010, 11, 209. [Google Scholar] [CrossRef]
  42. Musavizadeh, Z.; Najafi-Zarrini, H.; Kazemitabar, S.K.; Hashemi, S.H.; Faraji, S.; Barcaccia, G.; Heidari, P. Genome-Wide Analysis of Potassium Channel Genes in Rice: Expression of the OsAKT and OsKAT Genes under Salt Stress. Genes 2021, 12, 784. [Google Scholar] [CrossRef] [PubMed]
  43. Xuan, Y.H.; Piao, H.L.; Je, B.I.; Park, S.J.; Park, S.H.; Huang, J.; Zhang, J.B.; Peterson, T.; Han, C. Transposon Ac/Ds-induced chromosomal rearrangements at the rice OsRLG5 locus. Nucleic Acids Res. 2011, 39, e149. [Google Scholar] [CrossRef]
  44. Ahmadizadeh, M.; Chen, J.-T.; Hasanzadeh, S.; Ahmar, S.; Heidari, P. Insights into the genes involved in the ethylene biosynthesis pathway in Arabidopsis thaliana and Oryza sativa. J. Genet. Eng. Biotechnol. 2020, 18, 62. [Google Scholar] [CrossRef]
  45. Biłas, R.; Szafran, K.; Hnatuszko-Konka, K.; Kononowicz, A.K. Cis-regulatory elements used to control gene expression in plants. Plant Cell Tissue Organ Cult. 2016, 127, 269–287. [Google Scholar] [CrossRef]
  46. Faraji, S.; Ahmadizadeh, M.; Heidari, P. Genome-wide comparative analysis of Mg transporter gene family between Triticum turgidum and Camelina sativa. BioMetals 2021, 34, 639–660. [Google Scholar] [CrossRef]
  47. Cui, Q.; Yu, Z.; Purisima, E.O.; Wang, E. Principles of microRNA regulation of a human cellular signaling network. Mol. Syst. Biol. 2006, 2, 46. [Google Scholar] [CrossRef] [PubMed]
  48. Heidari, P.; Mazloomi, F.; Nussbaumer, T.; Barcaccia, G. Insights into the SAM synthetase gene family and its roles in tomato seedlings under abiotic stresses and hormone treatments. Plants 2020, 9, 586. [Google Scholar] [CrossRef]
  49. Amrutha, R.N.; Sekhar, P.N.; Varshney, R.K.; Kishor, P.B.K. Genome-wide analysis and identification of genes related to potassium transporter families in rice (Oryza sativa L.). Plant Sci. 2007, 172, 708–721. [Google Scholar] [CrossRef]
  50. Braun, P.; Aubourg, S.; Van Leene, J.; De Jaeger, G.; Lurin, C. Plant protein interactomes. Annu. Rev. Plant Biol. 2013, 64, 161–187. [Google Scholar] [CrossRef]
  51. Fukao, Y. Protein-protein interactions in plants. Plant Cell Physiol. 2012, 53, 617–625. [Google Scholar] [CrossRef]
  52. Kazemi, E.; Zargooshi, J.; Kaboudi, M.; Heidari, P.; Kahrizi, D.; Mahaki, B.; Mohammadian, Y.; Khazaei, H.; Ahmed, K. A genome-wide association study to identify candidate genes for erectile dysfunction. Brief. Bioinform. 2021, 22, bbaa338. [Google Scholar] [CrossRef]
  53. Hiruma, K.; Fukunaga, S.; Bednarek, P.; Piślewska-Bednarek, M.; Watanabe, S.; Narusaka, Y.; Shirasu, K.; Takano, Y. Glutathione and tryptophan metabolism are required for Arabidopsis immunity during the hypersensitive response to hemibiotrophs. Proc. Natl. Acad. Sci. USA 2013, 110, 9589–9594. [Google Scholar] [CrossRef]
  54. Ishihara, A.; Hashimoto, Y.; Tanaka, C.; Dubouzet, J.G.; Nakao, T.; Matsuda, F.; Nishioka, T.; Miyagawa, H.; Wakasa, K. The tryptophan pathway is involved in the defense responses of rice against pathogenic infection via serotonin production. Plant J. 2008, 54, 481–495. [Google Scholar] [CrossRef]
  55. Heidari, P.; Abdullah; Faraji, S.; Poczai, P. Magnesium transporter Gene Family: Genome-Wide Identification and Characterization in Theobroma cacao, Corchorus capsularis and Gossypium hirsutum of Family Malvaceae. Agronomy 2021, 11, 1651. [Google Scholar] [CrossRef]
  56. Mazid, M.; Khan, T.A.; Mohammad, F. Role of secondary metabolites in defense mechanisms of plants. Biol. Med. 2011, 3, 232–249. [Google Scholar]
  57. Jain, M. Next-generation sequencing technologies for gene expression profiling in plants. Brief. Funct. Genom. 2012, 11, 63–70. [Google Scholar] [CrossRef]
  58. Ghelis, T. Signal processing by protein tyrosine phosphorylation in plants. Plant Signal. Behav. 2011, 6, 942–951. [Google Scholar] [CrossRef] [PubMed]
  59. Ahmadizadeh, M.; Heidari, P. Bioinformatics study of transcription factors involved in cold stress. Biharean Biol. 2014, 8, 83–86. [Google Scholar]
  60. Goodstein, D.M.; Shu, S.; Howson, R.; Neupane, R.; Hayes, R.D.; Fazo, J.; Mitros, T.; Dirks, W.; Hellsten, U.; Putnam, N. Phytozome: A comparative platform for green plant genomics. Nucleic Acids Res. 2012, 40, D1178–D1186. [Google Scholar] [CrossRef] [PubMed]
  61. Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein Identification and Analysis Tools on the ExPASy Server. In The Proteomics Protocols Handbook; Humana Press: Totowa, NJ, USA, 2005; pp. 571–607. [Google Scholar]
  62. Bernsel, A.; Viklund, H.; Falk, J.; Lindahl, E.; von Heijne, G.; Elofsson, A. Prediction of membrane-protein topology from first principles. Proc. Natl. Acad. Sci. USA 2008, 105, 7177–7181. [Google Scholar] [CrossRef] [PubMed]
  63. Blom, N.; Sicheritz-Pontén, T.; Gupta, R.; Gammeltoft, S.; Brunak, S. Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence. Proteomics 2004, 4, 1633–1649. [Google Scholar] [CrossRef] [PubMed]
  64. Yu, C.-S.; Cheng, C.-W.; Su, W.-C.; Chang, K.-C.; Huang, S.-W.; Hwang, J.-K.; Lu, C.-H. CELLO2GO: A web server for protein subCELlular LOcalization prediction with functional gene ontology annotation. PLoS ONE 2014, 9, e99368. [Google Scholar] [CrossRef]
  65. Notredame, C.; Higgins, D.G.; Heringa, J. T-Coffee: A novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 2000, 302, 205–217. [Google Scholar] [CrossRef] [PubMed]
  66. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  67. Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.; Li, W.W.; Noble, W.S. MEME Suite: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, W202–W208. [Google Scholar] [CrossRef] [PubMed]
  68. Hu, B.; Jin, J.; Guo, A.-Y.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0: An upgraded gene feature visualization server. Bioinformatics 2015, 31, 1296–1297. [Google Scholar] [CrossRef]
  69. Voorrips, R.E. MapChart: Software for the Graphical Presentation of Linkage Maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]
  70. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
  71. Yang, Z.; Gu, S.; Wang, X.; Li, W.; Tang, Z.; Xu, C. Molecular evolution of the CPP-like gene family in plants: Insights from comparative genomics of Arabidopsis and rice. J. Mol. Evol. 2008, 67, 266–277. [Google Scholar] [CrossRef]
  72. Krzywinski, M.; Schein, J.; Birol, I.; Connors, J.; Gascoyne, R.; Horsman, D.; Jones, S.J.; Marra, M.A. Circos: An information aesthetic for comparative genomics. Genome Res. 2009, 19, 1639–1645. [Google Scholar] [CrossRef]
  73. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van De Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  74. Dai, X.; Zhuang, Z.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server (2017 release). Nucleic Acids Res. 2018, 46, W49–W54. [Google Scholar] [CrossRef]
  75. Franz, M.; Lopes, C.T.; Huck, G.; Dong, Y.; Sumer, O.; Bader, G.D. Cytoscape. js: A graph theory library for visualisation and analysis. Bioinformatics 2016, 32, 309–311. [Google Scholar]
  76. Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. STRING v11: Protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef] [PubMed]
  77. Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J.E. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [PubMed]
  78. Lovell, S.C.; Davis, I.W.; Arendall III, W.B.; De Bakker, P.I.W.; Word, J.M.; Prisant, M.G.; Richardson, J.S.; Richardson, D.C. Structure validation by Cα geometry: ϕ, ψ and Cβ deviation. Proteins Struct. Funct. Bioinform. 2003, 50, 437–450. [Google Scholar] [CrossRef]
  79. Willard, L.; Ranjan, A.; Zhang, H.; Monzavi, H.; Boyko, R.F.; Sykes, B.D.; Wishart, D.S. VADAR: A web server for quantitative evaluation of protein structure quality. Nucleic Acids Res. 2003, 31, 3316–3319. [Google Scholar] [CrossRef]
  80. Kim, J.-K.; Cho, Y.; Lee, M.; Laskowski, R.A.; Ryu, S.E.; Sugihara, K.; Kim, D.-S. BetaCavityWeb: A webserver for molecular voids and channels. Nucleic Acids Res. 2015, 43, W413–W418. [Google Scholar] [CrossRef]
  81. Wiederstein, M.; Sippl, M.J. ProSA-web: Interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Res. 2007, 35, W407–W410. [Google Scholar] [CrossRef] [PubMed]
  82. Wass, M.N.; Kelley, L.A.; Sternberg, M.J.E. 3DLigandSite: Predicting ligand-binding sites using similar structures. Nucleic Acids Res. 2010, 38, W469–W473. [Google Scholar] [CrossRef]
  83. Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; Van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [PubMed]
  84. Babicki, S.; Arndt, D.; Marcu, A.; Liang, Y.; Grant, J.R.; Maciejewski, A.; Wishart, D.S. Heatmapper: Web-enabled heat mapping for all. Nucleic Acids Res. 2016, 44, W147–W153. [Google Scholar] [CrossRef] [PubMed]
Academic Video Service