Fungal Pathogens on Bast Fiber Crops

Fungal Pathogens on Bast Fiber Crops: Comparison

Please note this is a comparison between Version 1 by Jianping Xu and Version 3 by Peter Tang.

Bast fiber crops are an important group of economic crops for the purpose of harvesting fibers from stems. These fibers are sclerenchyma fibers associated with the phloem of plants. They arise either with primary tissues from the apical meristem, or with secondary tissues produced by the lateral meristem. Fungal diseases have become an important factor limiting their yield and quality, causing devastating consequences for the production of bast fiber crops in many parts of the world.

bast fiber crops
molecular identification
fungal disease
DNA barcode
PCR assay

1. Introduction

Plant infectious diseases are among the most important constraints on the quality and yield of crops. It is estimated that plant diseases cause losses of 10%–15% of the world’s major crops, with direct economic losses of up to hundreds of billions of dollars each year. About 70%–80% of crop diseases are caused by fungal pathogens and the damage can be very serious, significantly reducing the yield and quality of many staple food crops and economic crops like fruits, vegetables, and fiber crops [1]. In addition, several fungal pathogens can secrete a variety of toxins and metabolites harmful to humans and animals, posing a great threat to the safety of agricultural products [2]. At present, most control measures against plant fungal pathogens rely on the applications of broad-spectrum fungicides. However, such fungicides not only increase production costs, but also can bring problems such as environmental pollution, fungicide resistance, and persistent residues on foods and other consumer goods with further implications for human health. In order to minimize the damage to crops caused by fungal diseases, as well as to maximize productivity and ensure agricultural sustainability, early detection and quantification of fungal pathogens is essential for disease prevention and control. However, conventional protocols based on morphological and physiological methods are time-consuming, require significant experience, and may not be sensitive and specific for individual pathogens [3]. Moreover, many fungal pathogens can remain latent in “sub-infection” stages with no obvious symptoms and/or in low numbers, making them difficult to detect, and causing confusion with regard to their roles in diseases. These issues can contribute to delayed or wrong control measures.

During the last three decades, to overcome these problems and minimize crop losses caused by fungal diseases, a diversity of DNA molecule-based tools has been developed for the detection and identification of fungal pathogens. These techniques include conventional polymerase chain reaction (PCR) [4], quantitative PCR (qPCR) ^[5][6][5,6], immunocapture-PCR (IC-PCR) ^[7][8][7,8], droplet digital PCR (dd-PCR) [9], loop-mediated isothermal amplification (LAMP) [10], multiplex tandem PCR [11], fluorescence in situ hybridization (FISH) [12], and DNA microarrays [3]. These methods are typically faster and more accurate than those based on colony morphology, microscopic features, and/or physiological/biochemical characters of pure fungal cultures. Indeed, methods targeting DNA sequences have been applied to detect pathogens during crops’ growth, harvest and post-harvest processing stages [13]. Moreover, they have also enabled a deeper understanding of microbial populations and communities associated with crops, especially the microorganisms that are difficult or impossible to cultivate in the lab. Together, technological advances and developments in DNA molecule-based methods have allowed fast and accurate detection and quantification of several fungal pathogens simultaneously in many important crops ^[14][15][14,15]. Information resulting from such work has been used to improve disease control and prevention with more rational decisions about the choice of fungicides to use, the appropriate cultivar(s) to plant, and necessary sanitary measures to apply during various stages of the crop production and processing cycle ^{[16][17][18][19]}[16,17,18,19].

2. Bast Fiber Crops

Bast fiber crops are an important group of economic crops for the purpose of harvesting fibers from stems [20]. These fibers are sclerenchyma fibers associated with the phloem of plants. They arise either with primary tissues from the apical meristem, or with secondary tissues produced by the lateral meristem. Bast fiber is one of four major types of natural plant fibers, with the other three being leaf fiber (e.g., banana and pineapple fibers), fruit and seed fiber (e.g., cotton and coconut fiber), and stalk fiber (e.g., straw fiber from rice, wheat, and bamboo). Bast fiber crops comprise six main species (flax, hemp, ramie, kenaf, jute, and sunn hemp) that are broadly cultivated (Table 1) as well as a few others (kudzu, linden, milkweed, nettle, okra, and paper mulberry) with more limited fiber production [21]. Table 1 summarizes the main bast fiber crops, including their geographic distributions, habitats, commercial use, and main fungal diseases.

Table 1. Major types of bast fiber crops and their distributions around the world ^[20][21][22][20,21,22].

Crop	Main Distribution	Main Characters of Growth Habitat	Main Applications	Main Fungal Diseases

3. Fungal Pathogens of Bast Fiber Crops

As shown in Table 1, most bast fiber crops can grow in a diversity of geographic regions and ecological niches. However, some of them have relatively limited geographic and/or ecological distributions and can’t grow well in certain environments. As a result, the types of land used to cultivate certain bast fiber crops may be limited and the same fields may be used to grow the same crop over many years. Even for bast fiber crops with broad ecological adaptability, the limited agricultural land in certain regions and the drive to seek high commercial benefits often mean that only certain types of fields are used for growing each specific crop. In these fields, fungal infectious diseases often increase over time, leading to large yield loss, or even total destruction of the harvest. Fungal pathogens occurring on bast fiber crops are taxonomically very broad (Table 2). Below we describe the major genera and species of fungal pathogens impacting bast fiber crops.

Table 2. List of fungal pathogens on bast fiber crops identified using molecular method.

Pathogen		Disease	Method	Marker

^[53][37,38,39]. In addition, it is difficult to distinguish the species within most fungal genera based on morphological features alone. However, most of them are relatively easy to identify using molecular markers, as described below (Table 2; Table 3).

Table 3. Genes and PCR primers used for their amplification in fungal pathogens infecting bast fiber crops.

Target DNA	Primer Name and Sequence (5′-3′)		Size of PCR Product (bp)		Host Plant	Geographic Region(s)	Reference
	Reference
Flax (Linum usitatissimum Linnaeus)	France, Russia, Netherlands, Belarus, Belgium, Canada, Kazakhstan, China, India
18S	Well-drained loam and cool, moist, temperate climates		Linen, flax yarn, flax seed, linseed oil	flax wilt, flax blight, flax anthracnose
18S	Alternaria						NS3				GCAAGTCTGGTGCCAGCAGCC	Not mentioned		^[54
Hemp (Cannabis sativa Linnaeus)												Not mentioned		^[54
A. alternata		China, Canada, USA, Europe, East Asia, Nepal	Hemp leaf spot	Grows at 16–27 °C, sufficient rain at the first six weeks of growth, short day length.	Conventional PCR	Textiles, hempseed oil, prescription drugs		ITS	hemp powdery mildew, hemp leaf spot disease, hemp blight, hemp root and crown rot wilt, hemp charcoal rot
	Cannabis sativa			Shanxi, China		^[23][46]	Jute (Corchorus capsularis Linnaeus)	India, Bangladesh, Burma, China	Tropical lowland areas, humidity of 60% to 90%, rain-fed crop
A. alternata		Ramie black leaf spot		Conventional PCR	Textiles, medicine	ITS, GAPDH	jute anthracnose, jute brown wilt, jute leaf spot
		Boehmeria nivea			Hunan, Hubei, China	^[24][47]	Kenaf (Hibiscus cannabinus Linnaeus)	India, Bangladesh, China, Malaysia, Thailand	Sandy loam and warm, humid subtropical, or tropical climates, few heavy rains or strong winds, at least 12 h light each day
Cercospora			Textiles		kenaf anthracnose, kenaf lack rot, kenaf sooty mold
^]							Ramie (Boehmeria nivea Linnaeus) Gaudich
^]	Cercospora cf. flagellaris		China, Brazil, Philippines, India, Vietnam, Laos, Cambodia		Hemp leaf spot disease	Sandy soil and warm, wet climates, rainfall averaging at least 75 to 130 mm per month	Not mentioned	Textiles, soil and water conservation, medicine	ITS, EF-1α, CAL, H3, actin	ramie anthracnose, ramie powdery mildew, ramie black leaf spot, ramie blight
	Cannabis sativa			Kentucky, USA		^[25][48]	Sunn Hemp (Crotalaria juncea Linnaeus)	India, USA, China	Wide variety of soil condition, altitude from 100 to 1000 m, temperatures above 28 °C, photoperiod-sensitive	Cover crop or green manure, forage producer
Colletotrichum					sunn hemp fusarium wilt, sunn hemp root rot, sunn hemp powdery mildew
C. corchorum capsularis		Jute anthracnose	ACT-512F	Conventional PCR		ACT, TUB2, CAL, GAPDH, GS, and ITS	Corchorus capsularis L.	Zhejiang, Fujian, Guangxi, and Henan, China	^[26][27]
	ATGTGCAAGGCCGGTTTCGC		300	^[25][48]	C. fructicola
ACT-783R	Jute anthracnose	Conventional PCR	300	^[25][48]	ACT, TUB2, CAL, GAPDH, GS, and ITS		TACGAGTCCTTCTGGCCCATCorchorus capsularis L.		Zhejiang, Fujian, Guangxi, and Henan, China		^[27][26]
C. fructicola		Jute anthracnose
ß-tubulin			Vd-btub-1F	Conventional PCR	GCGACCTTAACCACCTCGTT	ACT, TUB2, CAL, GAPDH, GS, and ITS	Not mentioned	Corchorus capsularis L.	Zhejiang, Fujian, Guangxi, and Henan, China	^[26	^[52][38^][27]
	]		C. gloeosporioides				Not mentioned				^[52][38^][27]
	]		Vd-btub-1R	Ramie anthracnose	Conventional PCR	ITS	CGCGGCTGGTCAGAGGA	Boehmeria nivea	HuBei, HuNan, JiangXi, and SiChuan, China	^[28][30]
	C. higginsianum		Ramie anthracnose	Conventional PCR	ITS
	VertBt-F		Boehmeria nivea		AACAACAGTCCGATGGATAATTC	HuBei, China		Not mentioned	^[52[29]
	^]	[	38	]	C. phormii		New Zealand flax anthracnose	Not mentioned	^[52[29]
	^]	[	38	]	VertBt-R	GTACCGGGCTCGAGATCG	Conventional PCR	ITS	Phormium tenax	California, USA	^[30][24]
	C. phormii		New Zealand flax anthracnose	Conventional PCR
	VITubF2	GCAAAACCCTACCGGGTTATG		ITS		Phormium tenax	143	^[53][39]	Perth, Australia	^[31][25]
	C. siamense		Jute anthracnose	Conventional PCR	ACT, TUB2, CAL, GAPDH, GS, and ITS	Corchorus capsularis L.	143	^[53][39]	Zhejiang, Fujian, Guangxi, and Henan, China	^[27
VITubRl	^]	[	26	]
	AGATATCCATCGGACTGTTCGTA	Colletotrichum sp.		Kenaf anthracnose	Conventional PCR	ITS	Corchorus olitorius	South Korea
VdTubF2	GGCCAGTGCGTAAGTTATTCT	82		^[	³²	^][28	^[]
⁵³	^]	82	[	39]	Curvularia		^[]
⁵³	^]	VdTubR4	[	39]	ATCTGGTTACCCTGTTCATCC	C. cymbopogonis		Hemp leaf spot
Bt2a		Conventional PCR		25S	GGTAACCAAATCGGTGCTGCTTTC	Not mentioned	^[27][26	Cannabis sativa	]	USA	^[33][52]
Exserohilum						Not mentioned	^[27][26		]
Bt2b	ACCCTCAGTGTAGTGACCCTTGGC	E. rostratum		Hemp floral blight	Not mentioned	ITS, RPB2	Cannabis sativa
CAL			CL1	GARTWCAAGGAGGCCTTCTC	Not mentioned	^[27][North Carolina, USA		^[34][49]
	26	]		Fusarium		^[27][North Carolina, USA
	26	]		CL2	Not mentioned	TTTTTGCATCATGAGTTGGAC	F. oxysporum
	CAL-228F	Hemp roots and crown rot	GAGTTCAAGGAGGCCTTCTCCC	Conventional PCR		ITS, EF-1α		Not mentioned	^[45Cannabis sativa		Canada	^[35][32]
^]	[	50	]	F. oxysporum		Jute brown wilt	Conventional PCR	Not mentioned	^[45Cannabis sativa	ITS	Corchorus olitorius	Dhaka, Manikgonj, Kishorgonj, Rangpur, and Monirampur, Bangladesh
^]	[	50	]	CAL-737R			CATCTTTCTGGCCATCATGG	^[	³⁶	^][40]
F. oxysporum
EF-1α	Hemp wilt	EF-1	Conventional PCR	ATGGGTAAGGAGGACAAGAC	ITS, EF-1α		700	Cannabis sativa	^[37][34	California, USA	^[37][34]
	]		F. solani		Hemp crown root	Conventional PCR	700	ITS, EF-1α	^[37][34	Cannabis sativa	Canada	^[35][32]
	]		EF-2	GGAGGTACCAGTGATCATGTT	F. solani		Hemp wilt	Conventional PCR	ITS, EF-1α
	EF1-728F	CATCGAGAAGTTCGAGAAGG	Not mentioned	^[45][50]	Cannabis sativa	California, USA		^[37][34]
	F. solani		Not mentioned	^[45][50]	Sunn hemp root rot and wilt	Conventional PCR
	EF2		ITS, EF-1α		Crotalaria juncea	Ceará, Brazil	^[	GGAGGTACCAGTGATCATGTT	^38][41]
F. brachygibbosum		Hemp wilt	Conventional PCR	ITS, EF-1α
EF1-728F		Cannabis sativa			California, USA	CATCGAGAAGTTCGAGAAGG	350	^[25][48]	^[37][34]
	F. udum f. sp. crotalariae		Sunn hemp fusarium wilt	Conventional PCR	EF-1α, β-tubulin	Crotalaria juncea	350	^[25][48]	Tainan, China	^[39][42]
	EF1-983R	TACTTGAAGGAACCCTTACC	Glomus
Endochitinase	Vd-endoch-1F	CTCGGAGGTGCCATGTACTG			Not mentioned
Endochitinase		^[	⁵²	^]	Not mentioned	[38]		G. mosseae		Hemp root rot Conventional PCR	25S	Cannabis sativa	USA
Vd-endoch-1R		^[	⁵²	^]		[38]		ACTGCCTGGCCCAGGTTC	^[	³³	^][52]
Golovinomyces
GAPDH	Vd-G3PD-2F	CACGGCGTCTTCAAGGGT	Not mentioned	^[52][38]	G. spadiceus		Hemp powdery mildew	Not mentioned	ITS, 28S
	Vd-G3PD-1R		Not mentioned	^[52][38]		CAGTGGACTCGACGACGTAC	Cannabis sativa	Kentucky, USA	^[40][43]
	G. cichoracearum sensu lato		Hemp powdery mildew	Conventional PCR
	GDF1	GCCGTCAACGACCCCTTCATTGA		Not mentioned	ITS	^[27][26]	Cannabis sativa	Atlantic Canada and British Columbia.	^[41][44]
	G. cichoracearum	Sunn hemp powdery mildew		Not mentioned	Not mentioned	^[27][26]	ITS	Crotalaria juncea	Florida, USA
	GDR1			GGGTGGAGTCGTACTTGAGCATGT	^[	⁴²	^][45]
Lasiodiplodia
gpd-1	CAACGGCTTCGGTCGCATTG	Not mentioned	^[24][47]	L. theobromae		Kenaf black rot	Conventional PCR	ITS	Corchorus olitorius	Kangar Perlis, Malaysia	^[43][54]
gpd-2	GCCAAGCAGTTGGTTGTGC	Not mentioned	^[24][47]	Leptoxyphium
GS					GSF1			ATGGCCGAGTACATCTGG
GS		Not mentioned			^[27][26]	L. kurandae		Kenaf sooty mould	Conventional PCR	ITS	Corchorus olitorius	Iksan, Korea	^[44][55]
[		Not mentioned			^[27][26]	31
[	GSR1	GAACCGTCGAAGTTCCAC	Macrophomina			31
]			Macrophomina phaseolina		Hemp charcoal rot	Conventional PCR	EF-1α, CAL	Cannabis sativa	Southern Spain	^[45][50]
]		Micropeltopsis
Micropeltopsis cannabis		Unknown	Conventional PCR	25S	Cannabis sativa	USA	^[33][52]
Orbilia
Orbilia luteola		Unknown	Conventional PCR	25S	Cannabis sativa	USA	^[33][52]
Pestalotiopsis
Pestalotiopsissp.		Hemp spot blight	Conventional PCR	25S	Cannabis sativa	USA	^[33][52]
Podosphaera
P. xanthii		Ramie powdery mildew	Conventional PCR	ITS	Boehmeria nivea	Naju, Korea	^[46][53]
Pythium
P. dissotocum		Browning and a reduction in root mass, stunting	Conventional PCR	ITS, EF-1α	Cannabis sativa	Canada	^[35][32]
P. myriotylum		Browning and a reduction in root mass, stunting	Conventional PCR	ITS, EF-1α	Cannabis sativa	Canada	^[35][32]
P. myriotylum		Hemp root rot and Wilt	Conventional PCR	ITS, COI, COII	Cannabis sativa	Connecticut, USA	^[47][33]
P. aphanidermatum		Hemp root rot and crown wilt	Conventional PCR	ITS	Cannabis sativa	California, USA	^[37][34]
P. aphanidermatum		Hemp crown and root Rot	Conventional PCR	ITS	Cannabis sativa	Indiana, USA	^[48][35]
P. ultimum		Hemp crown and root Rot	Conventional PCR	ITS	Cannabis sativa	Indiana, USA	^[49][36]
Rhizoctonia
ITS	ITS1	TCCGTAGGTGAACCTGCGG	334-738	^[30]^[28]^[48]^[49]^[51]^[52][24,30,35,36,37,38]
	ITS4	TCCTCCGCTTATTGATATGC	334-738	^[30]^[28]^[48]^[49]^[51]^[52][24,30,35,36,37,38]
	Binucleate R. spp.		Hemp wilt	Conventional PCR	25S	Cannabis sativa	USA	^[33][52]
	Sclerotinia
	Sclerotinia minor		Hemp crown rot	Conventional PCR	ITS	Cannabis sativa	San Benito County, Canada	^[50][51]
	Sphaerotheca
	S. macularis		Hemp powdery mildew	Conventional PCR	25S	V. dahliae		flax wilt	qPCR	ITS	Linum usitatissimum	Normandy, France	^[52][38]
	V. dahliae		flax wilt	qPCR	ß-tubulin	Linum usitatissimum	Germany	^[53][39]
	V. tricorpus		flax wilt	qPCR	ITS	Linum usitatissimum
	NS4	CTTCCGTCAATTCCTTTAAG
28S	LR0R	GCAAGTCTGGTGCCAGCAGCC	Not mentioned	^[54][31]
28S	LR3	GCAAGTCTGGTGCCAGCAGCC	Not mentioned	^[54][31]
25S	LROR	ACCCGCTGAACTTAAGC	1431	^[33][52]
25S	LR7	TACTACCACCAAGATCT	1431	^[33][52]
ACT
ACT	Vd-ITS1-45-F	CCGGTCCATCAGTCTCTCTG	334	^[51][37]
Vd-ITS2-379-R	ACTCCGATGCGAGCTGTAAC		334	^[51][37]
ITS1-F	CTTGGTCATTTAGAGGAAGTAA	700	^[37][34]
ITS4	TCCTCCGCTTATTGATATGC	700	^[37][34]
VtF4	CCGGTGTTGGGGATCTACT	123	^[53][39]
VtR2	GTAGGGGGTTTAGAGGCTG	123	^[53][39]
ITS 4	TCCTCCGCTTATTGATATGC	Not mentioned	^[27][26]
ITS 5	GGAAGTAAAAGTCGTAACAAGG	Not mentioned	^[27][26]
RPB2	bRPB2-6F	TGGGGYATGGTNTGYCCYGC		Cannabis sativa	USA	^[33][52]
RPB2	Verticillium
V. dahliae		flax wilt	Conventional PCR	ITS	Linum usitatissimum	La Haye Aubrée, France	^[51][37]		Germany	^[53][39]
V. longisporum		flax wilt	qPCR	ß-tubuIin	Linum usitatissimum	Germany	^[53][39]

qPCR: quantitative PCR, ITS: internal transcribed spacer, GAPDH: glyceraldehydes-3-phosphate dehydrogenase, GS: glutamate synthetase, EF-1α: translation elongation factor 1-α, CAL: calmodulin, H3: histone subunit 3, ACT: actin, TUB2: ß-tubulin, RPB2: RNA polymerase subunit B2, COI: cytochrome oxidase subunit I, COII: cytochrome oxidase subunit II.

4. Development of Molecular Identification of Bast Fiber Fungal Pathogens

At present, most diagnosis of bast fiber diseases rely on disease symptoms and, when available, cultural characteristics of isolated fungal pathogens on artificial media. However, it is often difficult to identify the underlying pathogen based on those characters alone. For example, the disease symptoms of Verticillium wilt in hemp is very similar to Fusarium wilt and the pathogen species in both genera can invade a wide range of economical crops ^[51][52]



	Not mentioned



	^[
³⁴
	^]
[
	49
]



bRPB2-7R


GAYTGRTTRTGRTCRGGGAAVGG

As early as 1997, a PCR-based method was used to help identify fungal pathogens of bast fiber crops. Specifically, McPartland et al. ^[33][52] amplified part of the 28S ribosomal RNA (rRNA) gene followed by EcoR I/Hind III digestion and electrophoresis to differentiate hemp fungal pathogens, and named two new species: Micropeltopsis cannabis sp. nov. and Orbilia luteola (Roum.) comb. nov. However, there were relatively few reports of fungal pathogens on bast fiber crops between 1998 and 2009, likely due to limited production of bast fiber crops and an emphasis on chemical fiber and other natural fibers. During this period, the acreage and production of bast fiber crops were low and there was limited research on these crops. Since 2009, with increasing production and research on bast fiber crops, there have been increasing reports on infectious diseases, including fungal diseases, on these crops ^[55][23]. This is especially true over the last five years when a large number of fungal pathogens were reported from bast fiber crops and many of these were identified based on molecular markers (Figure 1).

Figure 1. Development of molecular-based assays for the detection of fungal pathogens in bast fiber crops from 1997 until the present. For genus and species names, please see text and Table 2. Details of primers are shown in Table 3.

According to the National Center for Biotechnology Information (NCBI) PubMed, the most common literature on the molecular identification of fungal pathogens on bast fiber crops has been on hemp (including both industrial hemp and medicinal marijuana), accounting for ~45% of all published articles. This was then followed by flax and kenaf (at ~14% each), ramie (11%), and the rest being jute and sunn hemp. However, most of these reports were case reports.

5. Target DNA Selection and Molecular Assays of Fungal Pathogens on Bast Fiber Crops

Over the last three decades, several types of DNA-based methods have been developed and widely used to detect plant fungal pathogens. The invention of PCR technology using a thermostable polymerase by Kary Mullis gave birth to PCR in the early 1980s [4]. The invention of PCR has led to a diversity of PCR-based methods for fungal pathogen detections based on variations in DNA sequences within and among species (Figure 1, Table 2). Among these methods, qPCR is probably the most common molecular technology and it can be used for quantitative measurement of RNA and DNA, targeting both single nucleotide polymorphisms (SNPs) and copy number variations. qPCR allows not only the detection of whether a specific pathogen(s) is present in the sample, but also the quantification of pathogen levels in host tissues ^[5][6][5,6]. To improve the efficiency of conventional PCR, other methods have been coupled with PCR for plant fungal pathogen detection. For example, PCR in combination with enzyme-linked immunosorbent assay (ELISA) has been successfully applied to detect fungi, viruses, and bacteria, with high specificity [56]. Similarly, the highly specific IC-PCR approach can increase the sensitivity by 250 folds compared to conventional PCR amplification ^[7][8][7,8]. For absolute quantification without the need for references and standard curves, dd-PCR is the method of choice—this method is based on the combined technology of water–oil emulsion droplet and PCR [9]. In field conditions without ready access to laboratory equipment, LAMP can provide fast identifications of samples. LAMP uses six primers that are highly specific to target sites in a specific gene [10]. It can be carried out at a constant temperature in a short reaction time (<30 min). It is sensitive and cost-effective, potentially making it an ideal method for field detection of plant pathogens [57].

As shown in Table 2, PCR-based methods have been used as the main approach for detecting fungal pathogens in bast fiber crops. This pattern is similar to the detections of fungal pathogens in other crops in general. A number of DNA fragments and genes have been explored as potential targets for PCR-based detections, including the ribosomal RNA gene cluster, conserved housekeeping genes, and genes involved in the production of secondary metabolites, including mycotoxins ^[58][59][60][58,59,60]. Table 3 summarizes the genes and their primers that have been used for the detection and diagnostics of fungal pathogens on bast fiber crops. ThWe researchers would like to note that the molecular analyses reported so far for identifying fungal pathogens on bast fiber crops have been primarily using pure fungal strains, not those from diseased plant tissues. There is a large gap in applying these molecular methods in field conditions as a point-of-care test.

Among the DNA fragments that have been used for fungal pathogen detection, the most frequently used is the ribosomal RNA gene cluster. This gene cluster is composed of up to hundreds of repeating units with each unit containing the genes encoding the small (18S) ribosomal RNA subunit, the internal transcribed spacer (ITS) regions 1 and 2 that are separated by the 5.8S rRNA subunit, and the large (28S) ribosomal RNA subunit, with the intergenic spacer (IGS) region separating the adjacent units (Figure 2). The entire ITS fragment (which comprises ITS1, 5.8S rRNA, and ITS2) is typically 500–750 bp long and flanked by the 18S and 28S rRNA genes ^[61][62][63][61,62,63]. The ITS regions are present in all known fungi and have both highly conserved flanking regions located in the 5.8S, 18S, and 28S rRNA genes as well as the variable regions (located in the ITS1 and ITS2 regions). The conserved flanking regions allowed the development of highly conserved probes or primers to amplify most, if not all, fungi, while the variable regions allowed the development of species-specific markers ^[64][65][64,65]. Together, these features have contributed to ITS being the consensus fungal DNA barcode for the mycological community ^[64][65][64,65]. Furthermore, the ITS sequences obtained from the direct amplification and sequencing of environmental DNA samples have contributed to our increased understanding of fungal diversity from a variety of environments, including those from diseased plants and animals ^[65][66][65,66].

Figure 2. A schematic representation of the fungal ribosomal RNA gene cluster showing the locations of individual DNA fragments and the common primers used for PCR amplification.