Your browser does not fully support modern features. Please upgrade for a smoother experience.
Breast Cancer Aptamers: Comparison
Please note this is a comparison between Version 2 by Amina Yu and Version 3 by Anna Ignaszak.

The aptamer was also tested in vivo with mice models and was able to inhibit breast cancer progression. This aptamer proves promising for therapeutic treatment of breast cancer and likely sensing as well due to its high specificity and affinity. The RNA aptamer pegaptanib sodium, commonly shortened to pegaptanib, binds only to the VEGF165isoform, and selectively binds with the heparin-binding site.

  • cancer
  • cancer detection
  • aptamers
  • diagnostics
  • breast cancer
  • cancer biomarkers
  • sensors
  • aptasensors
  • electrochemical sensing
  • biosensors

1. Introduction

Accounting for 25% of all cancers in women, breast cancer (BC) is the most commonly occurring cancer in women worldwide [1]. BC is a notoriously heterogeneous disease, with the World Health Organization recognizing at least 17 subtypes [2]. Traditional classification of breast cancer subtypes focuses on two criteria: the tissue affected and level of invasiveness. Carcinomas, accounting for 99% of breast cancers, arise from the epithelial component of the breast. Sarcomas, the rarer of the two, arise from connective tissue such as bones, nerves, and muscles. After establishing whether the cancer is a carcinoma or sarcoma, one can further separate the cancer subtypes into non-invasive, invasive, and metastatic categories [3]. Metastasis occurs when the cancer spreads to tissue or organs beyond the original site; it is the leading cause of death in cancer patients [4]. The current standard of screening for breast cancer is mammography, clinical breast examination, and routine self-breast examination [5]. For women of all ages and at average risk, these screening methods reduce mortality by 20% [6].

It is well established in the literature that early detection is essential to improved outcomes and reduced mortality. Ensuring early screening is affordable, timely, and effective care is key to successful implementation of these programs [7]. Aptamers are oligonucleotides, either RNA or single-stranded DNA, that bind specifically to target molecules as a result of their unique folding and 3D composition [8]. In diagnosis, aptamers generally bind with high specificity and affinity, resulting in a conformational change that can be measured and quantified via electrochemical parameters such as resistivity, voltammetry, and amperometry [9][10], as well as through optical methods such as fluorescence and colorimetry [11]. Using aptamers to identify biomarkers of breast cancer provides more information about the characteristics of each patient’s cancer, thus allowing clinicians to make better benefit–risk assessments and provide a better level of care.

Aptasensors could also provide an alternative screening option for women in the age groups where standard screening is not recommended. Assessing metastasis through aptamer-based sensing is also a platform of great interest, as metastasis is responsible for most breast cancer deaths and early intervention is crucial [3]. Aptamer-based electrochemical sensing is an ideal candidate for breast cancer screening as they are generally highly sensitive, low cost, and portable [12]. Currently no aptasensors are commercially available for oncological use or disease diagnosis, despite the presence of seemingly functional aptasensors existing in literature that use point-of-care friendly technology such as smartphone linking [13]. In regard to drug delivery, the majority of oncological clinical trials focus on aptamer AS1411 and NOX-A12, neither of which have completed clinical trials past phase II [14].

The comparison of aptamers ( Table 1 ) provides another variable to modify in the search for rapid, affordable, and accessible aptamer-based diagnosis and therapeutics for the fight against breast cancer.

Table 1. The current available targets, their location, special characteristics, benefits for selection as a target, and challenges in use.
Target Location Characteristics Benefits for Targeting Challenges of Use
Alpha estrogen receptor Mammary glands Ligand-inducible transcription factor. Found in 75% of breast cancers.

Responsive to targeted hormone therapies.
Resistance to hormone therapy easily developed, proper identification critical to effective therapy.
Mucin 1 Expressed on circulating tumor cells Transmembrane glycoprotein. Indicator of cancer remission status.

Large number of aptamers already exist.

Overexpressed in 90% of breast cancers.
Overexpressed in multiple epithelial cancers, not exclusive to breast cancer.
Vascular endothelial growth factor Endothelial cells Secreted glycoproteins. Angiogenic factor—stimulates the growth of new blood vessels. Immunosuppressive. Predictive factor for overall survival and response to antiangiogenic treatment. Overexpressed in multiple solid cancers as well as rheumatoid arthritis. Not exclusive to breast cancer and cancers.
Periostin Secreted into the tumor microenvironment Multimodular protein. Found overexpressed in up to 83% of invasive breast carcinoma patients [15]. Positive correlation between periostin levels and age; currently no normal range established.
Epithelial cell adhesion molecule Trans- and intermembrane domains on epithelial and cancer cells [16] Transmembrane glycoprotein.

Responsible for cell adhesion, proliferation, and migration.
High expression on rapidly proliferating cells. Overexpression is seen in roughly 82% of metastatic breast cancers [17]. Higher expression seen in metastatic cancers. Poor viability for early cancer detection, thus shifting focus to late-stage cancer monitoring and drug targeting.
Nucleolin Found primarily in the nucleolus Phosphoprotein with RNA recognition motifs. Predictive factor for multiple cancers, particularly potent prognostic factor for BC. Expressed in multiple cancers, not specific to breast.

High levels indicate poor outcomes for breast cancer but positive outcomes for other cancers.
Cancer antigen 15-3 Found in serum Soluble product of the MUC-1 gene. Can be used to distinguish bone metastasis from other types of metastases.

Predictive factor for overall and disease-free survival.

Indicator of metastatic potential in active treatment.
Current antibody-based sensors already exist with low LOD and short processing times.
Carcinoembryonic Antigen Secreted into the tumor microenvironment Secreted glycoproteins. Elevated levels are indicative of cancer progression or recurrence. Traditionally not recommended for screening due to low specificity.
Human epidermal growth factor 2 Transmembrane protein found overexpressed on breast cancer cells. Transmembrane glycoprotein found in both tissue and circulating tumor cells Overexpressed in 20–25% of breast cancers.

Concentration exceeding 15 ng/mL in blood indicates HER2-positive breast cancer.

HER2+ breast cancer is a more aggressive molecular subtype.

Many aptamers already available.
Relatively low levels of expression.

2. Breast Cancer Biomarkers and Existing Aptamers

Estrogen receptor α (ERα) and transcriptional activity associated with the receptor is a driving force in approximately 75% of breast cancers [18]. ERα is a ligand inducible transcription factor responsible for estrogen signaling and is primarily found in mammary glands as well as other organs such as ovaries [19][20]. When estrogen binds to ERα, signaling pathways are activated that lead to tumor growth and proliferation in cells that have an excess of these receptors [21]. Targeted hormone therapies for these subtypes of BC exist, but resistance is easily developed [22]; therefore, early identification leads to better overall treatment outcomes.

Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein responsible for cell adhesion, proliferation, and migration. EpCAM can be used as a prognostic factor for multiple cancers; interestingly, high expression for some cancers (such as breast) is associated with poor clinical outcomes, whereas the inverse is true for other cancers (such as thyroid cancer) [23]. EpCAM has been found to be a particularly potent biomarker for breast cancer metastisis, known to be one of the most important factors in patient mortality [24]. CellSearch is the only clinically validated method of detecting EpCAM in metastatic breast cancer patients and works by conjugating EpCAM-specific antibodies with ferrofluid, allowing for magnetic separation. The biggest downfall of this system is that only high EpCAM-expressing cells are detected [25][26].

The majority of electrochemical sensors in the last five years has focused on detection of EpCAM in serum and blood, rather than the tumor microenvironment [27][28][29]. Recent work has used SYL3C to target circulating tumor cells [30], which express EpCAM on their cell surface [31], with a limit of detection of 10aM being reported by Zhu et al. [28].

In normal cells nucleolin, a phosphoprotein with RNA recognition motifs, is found primarily in the nucleolus [32]. In cancerous cells, the amount of nucleolin on the cell surface has been found to be abnormally high. This overexpression of nucleolin is associated with poorer patient outcomes as the protein is known to promote carcinogenesis, proliferation, metastasis, and angiogenesis [33]. Nucleolin expression determination with antibodies requires tissue samples, and as such is an invasive procedure [34].

3. Serum Markers

Carcinoembryonic antigens (CEA) are glycoproteins found both in the tumor microenvironment (TME) and secreted into the blood. Rising or elevated levels are indicative of cancer progression or recurrence and are useful for monitoring already diagnosed cases of breast cancer [35]. Historically, CEA is not recommended for pre-screening due to low specificity and is being replaced by more specific markers [36].

The most common is CEAAp1 and has the sequence 5′-ATACCAGCTTATTCAATT-3 [37]. Parameters such as binding affinity, binding motif, and specificity of this DNA aptamer are severely lacking in the literature but use of this aptamer for sensing is common [37][38][39]. Using voltametric methods, sensors using aptamer CEAAp1 consistently get obtain high sensitivities in the Pico and femtogram range [38]. Work needs to be done to better understand whether the use of this aptamer is common due to standard or because it has actual benefit over other developed aptamers [40][41].

RNV66 also binds multiple isoforms of VEGF and uses a locked nucleic acid (LNA) strategy to provide stabilization by resistance to nucleases and increased binding affinity [42]. In LNA, the ribose ring has a methylene linkage between the 2′-oxygen and 4′-carbon, thereby constraining the ring [43]. The benefit of LNA is that the resulting aptamer is better stabilized both in vivo and in vitro. This aptamer targets both VEGF 121 and VEGF 165 isoforms with high affinity and specificity and is based on the previously mentioned Vap7 aptamer. RNV66 was tested on both normal and cancerous epithelial breast cell lines and was found to be toxic to cancerous cells while having no significant effect on the normal breast cell line. The aptamer was also tested in vivo with mice models and was able to inhibit breast cancer progression [42]. This aptamer proves promising for therapeutic treatment of breast cancer and likely sensing as well due to its high specificity and affinity.

Part of the pathological evaluation of breast cancer is the evaluation of hormone receptor expression. Progesterone receptors, such as estrogen receptors, are one of the key hormone receptors that dictate treatment options. Unlike estrogen, the predictive/prognostic value of progesterone receptor expression is controversial [44]. The evaluation of progesterone receptor expression has been found to only be useful in a subset of patients already determined to be ER+ [45]. This gives an explanation as to why the authors were unable to find any progesterone aptamers for use in breast cancer. Exploration of progesterone receptor aptamers is impractical at this time as their predictive value is still highly debated and possibly overshadowed by that of estrogen receptors.

4. Conclusions

The entry have identified all known aptamers for specific biomarkers associated with breast cancer ( Table 2 ) and compared the benefits and limitations of each.The focus was on aptamers with specific molecular targets rather than cancer cell lines of tissue, chose to do this as specific targets provide better diagnostic value and clinical application. Parameters of some aptamers are very limited, making them impractical for clinical use without further investigation.

Table 2. Summary of the known breast cancer targets, available aptamers for targeting biomarkers, the binding constants, and respective Gibbs free energy.
Target Aptamer Name Sequence 5′→3′ Association Constant (Ka) Dissociation Constant (KD) ΔG (kcal/mol)
Alpha estrogen receptor ERaptD4 ATACCAGCTTATTCAATTCGTTGCATTTAGGTGCATTACGGGGGTTATCCGCTCTCTCAGATAGTATGTGCAATCA 1.55 ± 0.29 × 108 M−1 N/A N/A
Mucin 1 5TR1 GAAGTGAAAATGACAGAACACAACA 0.20 × 107 M−1s−1 47.3 nM N/A
  S2.2 GCAGTTGATCCTTTGGATACCCTGG 0.401 × 107 M−1s−1 0.135 nM N/A
  MA3 AACCGCCCAAATCCCTAAGAGTCGGACTGCAACCTATGCTATCGTTGATGTCTGTCCAAGCAACACAGACACACTACACACGCACA N/A 38.3 nM N/A
Vascular endothelial growth factor Vap7 ATACCAGTCTATTCAATTGCACTCTGTGGGGGTGGACGGGCCGGGTAGATAGTATGTGCAATCA N/A 1.0 nM (121) and 20 nM (165) N/A
  V7t1 TGTGGGGGTGGACGGGCCGGGTAGA N/A 1.1 nM (121) and 1.4 nM (165) N/A
  RNV66 TGTGGGGGTGGACGGGCCGGGTAGA N/A N/A −9.34 28:28 10.34 (lowest listed)
  Pegaptanib CGGAAUCAGUGAAUGCUUAUACAUCCG N/A 49 pM N/A
  ARC247 CGAUAUGCAGUUUGAGAAGUCGCGCAUUCG N/A 2 nM N/A
Periostin PNDA-3 ACGAGYYGYCGCAYGYGCGGYYCAGYCYGGYCCYYCAGCACCGYACAACAA *Y, Benzyl-d(U)TP N/A 1.07 nM N/A
Epithelial cell adhesion molecule SYL3 AGCGTCGAATACCACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGCTAATGGAGCTCGTGGTCAG N/A 87 ± 17 nM (MDA-MB-231) and 185 ± 22 nM (Kato III) N/A
  EpDT3 GCGACUGGUUACCCGGUCG N/A 12.0 ± 6.5 nM N/A
  EpApt-siEp GCUGGCCCAUUGGUCAGC N/A N/A N/A
Nucleolin AS1411 TTTGGTGGTGGTGGTTGTGGTGGTGGTGG N/A N/A N/A
Cancer antigen 15-3 Clone 2 GAAGTGAATATGACAGATCACAACT N/A 45.47 ± 3.415 nM N/A
  Clone 4 TACTGCATGCAGACCACATCAACTT N/A 67.1 ± 3.289 nM N/A
  Clone 5 CATACAATCAATCACCAGTGCGGTG N/A 81.56 ± 4.198 nM N/A
Carcinoembryonic antigen Wang et al. (2007) N/A N/A N/A N/A
  CEAAp1 TTAACTTATTCGACCATA N/A N/A N/A
  Apta 3 GGGGGGTGTATCGTTGACGAGTTGCGCGTGCGTCTCGTG N/A 60.4 ± 5.7 nM −18.69
  Apta 5 GGAGCTACGTTTAGCGAGTCCGACGCTCGGTGCCTCTTC N/A 37.8 ± 5.8 nM −13.06 kcal/mol
Human epidermal growth factor 2 HeA2_1 ATTAAGAACCATCACTCTTCCAAATGGATATACGACTGGG N/A 28.9 nM −7.82 kcal/mol
  HeA2_3 TCTAAAAGGATTCTTCCCAAGGGGATCCAATTCAAACAGC N/A 6.2 nM −9.27 kcal/mol
  H2 GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC N/A 270 nM −6.69 kcal/mol
  TSA14 GCUGGAGCAUUUAUGGAUGAACCUUGGACGGAA N/A 133.9 ± 12.78 nM −9.68
  SE15-8 AAAATACCAAATAAGGAAGCAAGGCAGAACGGGGCCTACTGTGTATATCATC N/A 10 nM N/A
  SE15-8 (mini) AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU N/A 3.49 ± 1.3 × 10 nM N/A
  HB5 AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA N/A 18.9 nM (peptide) and 316 nM (ECD) N/A
  HY6 TGCCCGTGTCCCGAGGAGGTGCCCTATTTTGCTTGATTATCTCTAAGGGATTTGGGCGG N/A 183 nM (peptide) and 172 nM (ECD) N/A
  Heraptamer1 ACACCACATCCGTCTTACTCCCCAATTACA N/A 5.1 ± 5.3 N/A
  Heraptamer2 TCCACCTTTCCGTCTAACTCCCCACTTTAT N/A 23.7 ± 11.2 N/A
  ECD_Apt1 CCGCAACCACGACCGAAAGACAACGCAATCTGACACGTGG

If aptamers are to be used for the diagnosis and treatment of breast cancer, some factors should be focused on. It is crucial that greater cross-reactivity and clinical sample studies are conducted to ensure high specificity of these aptamers. Breast cancer treatments, such as chemotherapy, pose a very real harm to those who are in fact healthy and incorrectly diagnosed, and therefore the reliability of these aptamers must be held to the highest standard.

As sensing platforms continue to develop, aptamers hold great potential for point-of-care diagnosis in the fight against breast cancer. Many aptasensors exist that exemplify proof-of-concept for use at the bedside and have been used on clinical samples [10], but to public knowledge, none are currently on market or being used as standard in clinical settings. Commercialization of aptasensors is proving to be a difficult feat, as antibody assays are well established, and educating investors and physicians on the benefits of aptamers can prove to be difficult. For hospitals, simple biosensor interfacing and the lack of specialized equipment should allow for simple point-of-care testing, thus reducing laboratory load and costs [46]. Although beneficial in the long term, this transition from a centralized lab to a decentralized point-of-care approach would require extra effort and expense.

Despite the work already achieved, further study and clinical trials are paramount in making the use of aptamers widespread and increasingly viable. With an increased focus on the development of new aptamers for targeting select cancer biomarkers, researchers should be able to leverage the high specificity and binding affinities of aptamers to develop potent drugs and sensing platforms. If completed, the use of aptamers for cancer diagnostics has the potential to provide a highly specific and sensitive platform that is simultaneously quick and user friendly. These aptamers display potential for not only the detection of cancers but can be further leveraged to target cancers for therapy. In either case, aptamers have the potential to help us make strides towards a world where treatment is quick to start and efficient in use.

References

  1. DeSantis, C.E.; Bray, F.; Ferlay, J.; Lortet-Tieulent, J.; Anderson, B.O.; Jemal, A. International Variation in Female Breast Cancer Incidence and Mortality Rates. Cancer Epidemiol. Biomark. Prev. 2015, 24, 1495–1506.
  2. Weigelt, B.; Geyer, F.C.; Reis-Filho, J.S. Histological types of breast cancer: How special are they? Mol. Oncol. 2010, 4, 192–208.
  3. Feng, Y.; Spezia, M.; Huang, S.; Yuan, C.; Zeng, Z.; Zhang, L.; Ji, X.; Liu, W.; Huang, B.; Luo, W.; et al. Breast cancer development and progression: Risk factors, cancer stem cells, signaling pathways, genomics, and molecular pathogenesis. Genes Dis. 2018, 5, 77–106.
  4. Scully, O.J.; Bay, B.-H.; Yip, G.; Yu, Y. Breast Cancer Metastasis. Cancer Genom. Proteom. 2012, 9, 311–320.
  5. Vieira, R.A.D.C.; Biller, G.; Uemura, G.; Ruiz, C.A.; Curado, M.P. Breast cancer screening in developing countries. Clinics 2017, 72, 244–253.
  6. Myers, E.R.; Moorman, P.G.; Gierisch, J.M.; Havrilesky, L.J.; Grimm, L.; Ghate, S.V.; Davidson, B.; Mongtomery, R.C.; Crowley, M.J.; McCrory, D.C.; et al. Benefits and Harms of Breast Cancer Screening. JAMA 2015, 314, 1615–1634.
  7. Ginsburg, O.; Yip, C.; Brooks, A.; Cabanes, A.; Caleffi, M.; Yataco, J.A.D.; Gyawali, B.; McCormack, V.; de Anderson, M.M.; Mehrotra, R.; et al. Breast cancer early detection: A phased approach to implementation. Cancer 2020, 126, 2379–2393.
  8. Keefe, A.D.; Pai, S.; Ellington, A. Aptamers as therapeutics. Nat. Rev. Drug Discov. 2010, 9, 537–550.
  9. Hong, P.; Li, W.; Li, J. Applications of Aptasensors in Clinical Diagnostics. Sensors 2012, 12, 1181–1193.
  10. Díaz-Fernández, A.; Lorenzo-Gómez, R.; Miranda-Castro, R.; De-Los-Santos-Álvarez, N.; Lobo-Castañón, M.J. Electrochemical aptasensors for cancer diagnosis in biological fluids—A review. Anal. Chim. Acta 2020, 1124, 1–19.
  11. Liu, L.S.; Wang, F.; Ge, Y.; Lo, P.K. Recent Developments in Aptasensors for Diagnostic Applications. ACS Appl. Mater. Interfaces 2020, 13, 9329–9358.
  12. Li, Z.; Mohamed, M.A.; Mohan, A.M.V.; Zhu, Z.; Sharma, V.; Mishra, G.K.; Mishra, R.K. Application of Electrochemical Aptasensors toward Clinical Diagnostics, Food, and Environmental Monitoring: Review. Sensors 2019, 19, 5435.
  13. Citartan, M.; Tang, T.-H. Recent developments of aptasensors expedient for point-of-care (POC) diagnostics. Talanta 2019, 199, 556–566.
  14. Lao, Y.-H.; Phua, K.K.; Leong, K. Aptamer Nanomedicine for Cancer Therapeutics: Barriers and Potential for Translation. ACS Nano 2015, 9, 2235–2254.
  15. Kim, G.-E.; Lee, J.S.; Park, M.H.; Yoon, J.H. Epithelial periostin expression is correlated with poor survival in patients with invasive breast carcinoma. PLoS ONE 2017, 12, e0187635.
  16. Trzpis, M.; McLaughlin, P.M.; de Leij, L.M.; Harmsen, M.C. Epithelial Cell Adhesion Molecule: More than a Carcinoma Marker and Adhesion Molecule. Am. J. Pathol. 2007, 171, 386–395.
  17. Cimino, A.; Halushka, M.; Illei, P.; Wu, X.; Sukumar, S.; Argani, P. Epithelial cell adhesion molecule (EpCAM) is overexpressed in breast cancer metastases. Breast Cancer Res. Treat. 2009, 123, 701–708.
  18. Siersbæk, R.D.; Kumar, S.; Carroll, J. Signaling pathways and steroid receptors modulating estrogen receptor α function in breast cancer. Genes Dev. 2018, 32, 1141–1154.
  19. Paterni, I.; Granchi, C.; Katzenellenbogen, J.A.; Minutolo, F. Estrogen receptors alpha (ERα) and beta (ERβ): Subtype-selective ligands and clinical potential. Steroids 2014, 90, 13–29.
  20. Nassa, G.; Giurato, G.; Salvati, A.; Gigantino, V.; Pecoraro, G.; Lamberti, J.; Rizzo, F.; Nyman, T.A.; Tarallo, R.; Weisz, A. The RNA-mediated estrogen receptor α interactome of hormone-dependent human breast cancer cell nuclei. Sci. Data 2019, 6, 1–8.
  21. Zattarin, E.; Leporati, R.; Ligorio, F.; Lobefaro, R.; Vingiani, A.; Pruneri, G.; Vernieri, C. Hormone Receptor Loss in Breast Cancer: Molecular Mechanisms, Clinical Settings, and Therapeutic Implications. Cells 2020, 9, 2644.
  22. Jeselsohn, R.; Yelensky, R.; Buchwalter, G.; Frampton, G.; Meric-Bernstam, F.; Gonzalez-Angulo, A.M.; Ferrer-Lozano, J.; Perez-Fidalgo, J.A.; Cristofanilli, M.; Gomez, H.; et al. Emergence of Constitutively Active Estrogen Receptor-α Mutations in Pretreated Advanced Estrogen Receptor–Positive Breast Cancer. Clin. Cancer Res. 2014, 20, 1757–1767.
  23. Gires, O.; Pan, M.; Schinke, H.; Canis, M.; Baeuerle, P.A. Expression and function of epithelial cell adhesion molecule EpCAM: Where are we after 40 years? Cancer Metastasis Rev. 2020, 39, 969–987.
  24. Zeng, L.; Zeng, L.; Deng, X.; Deng, X.; Zhong, J.; Zhong, J.; Yuan, L.; Yuan, L.; Tao, X.; Tao, X.; et al. Prognostic value of biomarkers EpCAM and αB-crystallin associated with lymphatic metastasis in breast cancer by iTRAQ analysis. BMC Cancer 2019, 19, 831.
  25. Politaki, E.; Agelaki, S.; Apostolaki, S.; Hatzidaki, D.; Strati, A.; Koinis, F.; Perraki, M.; Saloustrou, G.; Stoupis, G.; Kallergi, G.; et al. A Comparison of Three Methods for the Detection of Circulating Tumor Cells in Patients with Early and Metastatic Breast Cancer. Cell. Physiol. Biochem. 2017, 44, 594–606.
  26. De Wit, S.; Van Dalum, G.; Lenferink, A.T.M.; Tibbe, A.G.J.; Hiltermann, T.J.N.; Groen, H.J.M.; van Rijn, C.; Terstappen, L.W.M.M. The detection of EpCAM+ and EpCAM– circulating tumor cells. Sci. Rep. 2015, 5, 12270.
  27. Pei, Y.; Ge, Y.; Zhang, X.; Li, Y. Cathodic photoelectrochemical aptasensor based on NiO/BiOI/Au NP composite sensitized with CdSe for determination of exosomes. Microchim. Acta 2021, 188, 51.
  28. Zhu, L.; Yang, B.; Qian, K.; Qiao, L.; Liu, Y.; Liu, B. Sensitive electrochemical aptasensor for detecting EpCAM with silica nanoparticles and quantum dots for signal amplification. J. Electroanal. Chem. 2020, 856, 113655.
  29. Chen, Q.; Hu, W.; Shang, B.; Wei, J.; Chen, L.; Guo, X.; Ran, F.; Chen, W.; Ding, X.; Xu, Y.; et al. Ultrasensitive amperometric aptasensor for the epithelial cell adhesion molecule by using target-driven toehold-mediated DNA recycling amplification. Microchim. Acta 2018, 185, 202.
  30. Hashkavayi, A.B.; Cha, B.S.; Hwang, S.H.; Kim, J.; Park, K.S. Highly sensitive electrochemical detection of circulating EpCAM-positive tumor cells using a dual signal amplification strategy. Sens. Actuators B Chem. 2021, 343, 130087.
  31. De Wit, S.; Manicone, M.; Rossi, E.; Lampignano, R.; Yang, L.; Zill, B.; Rengel-Puertas, A.; Ouhlen, M.; Crespo, M.; Berghuis, A.M.S.; et al. EpCAMhigh and EpCAMlow circulating tumor cells in metastatic prostate and breast cancer patients. Oncotarget 2018, 9, 35705–35716.
  32. Tajrishi, M.M.; Tuteja, R.; Tuteja, N. Nucleolin: The Most Abundant Multifunctional Phosphoprotein of Nucleolus. Commun. Integr. Biol. 2011, 4, 267–275.
  33. Chen, Z.; Xu, X. Roles of nucleolin. Saudi Med. J. 2016, 37, 1312–1318.
  34. Lin, Q.; Ma, X.; Hu, S.; Li, R.; Wei, X.; Han, B.; Ma, Y.; Liu, P.; Pang, Y. Overexpression of Nucleolin is a Potential Prognostic Marker in Endometrial Carcinoma. Cancer Manag. Res. 2021, 13, 1955–1965.
  35. Wang, W.; Xu, X.; Tian, B.; Wang, Y.; Du, L.; Sun, T.; Shi, Y.; Zhao, X.; Jing, J. The diagnostic value of serum tumor markers CEA, CA19-9, CA125, CA15-3, and TPS in metastatic breast cancer. Clin. Chim. Acta 2017, 470, 51–55.
  36. Kabel, A.M. Tumor markers of breast cancer: New prospectives. J. Oncol. Sci. 2017, 3, 5–11.
  37. Shu, H.; Wen, W.; Xiong, H.; Zhang, X.; Wang, S. Novel electrochemical aptamer biosensor based on gold nanoparticles signal amplification for the detection of carcinoembryonic antigen. Electrochem. Commun. 2013, 37, 15–19.
  38. Xiang, W.; Lv, Q.; Shi, H.; Xie, B.; Gao, L. Aptamer-based biosensor for detecting carcinoembryonic antigen. Talanta 2020, 214, 120716.
  39. Zhou, X.; Xue, S.; Jing, P.; Xu, W. A sensitive impedimetric platform biosensing protein: Insoluble precipitates based on the biocatalysis of manganese(III) meso-tetrakis (4-N-methylpyridiniumyl)-porphyrinin in HCR-assisted dsDNA. Biosens. Bioelectron. 2016, 86, 656–663.
  40. Lee, Y.J.; Han, S.R.; Kim, N.Y.; Lee, S.; Jeong, J.; Lee, S. An RNA Aptamer That Binds Carcinoembryonic Antigen Inhibits Hepatic Metastasis of Colon Cancer Cells in Mice. Gastroenterology 2012, 143, 155–165.
  41. Pan, Q.; Law, C.O.K.; Yung, M.M.H.; Han, K.C.; Pon, Y.L.; Lau, T.C.K. Novel RNA aptamers targeting gastrointestinal cancer biomarkers CEA, CA50 and CA72-4 with superior affinity and specificity. PLoS ONE 2018, 13, e0198980.
  42. Edwards, S.L.; Poongavanam, V.; Kanwar, J.R.; Roy, K.; Hillman, K.M.; Prasad, N.; Leth-Larsen, R.; Petersen, M.; Marušič, M.; Plavec, J.; et al. Targeting VEGF with LNA-stabilized G-rich oligonucleotide for efficient breast cancer inhibition. Chem. Commun. 2015, 51, 9499–9502.
  43. Braasch, D.A.; Corey, D.R. Locked nucleic acid (LNA): Fine-tuning the recognition of DNA and RNA. Chem. Biol. 2001, 8, 1–7.
  44. Hefti, M.M.; Hu, R.; Knoblauch, N.W.; Collins, L.C.; Haibe-Kains, B.; Tamimi, R.M.; Beck, A.H. Estrogen receptor negative/progesterone receptor positive breast cancer is not a reproducible subtype. Breast Cancer Res. 2013, 15, R68.
  45. Taneja, P.; Maglic, D.; Kai, F.; Zhu, S.; Kendig, R.D.; Elizabeth, A.F.; Inoue, K. Classical and Novel Prognostic Markers for Breast Cancer and their Clinical Significance. Clin. Med. Insights Oncol. 2010, 4.
  46. Prante, M.; Segal, E.; Scheper, T.; Bahnemann, J.; Walter, J. Aptasensors for Point-Of-Care Detection of Small Molecules. Biosensor 2020, 10, 108.
More
Academic Video Service