1. Genus Diaporthe
The genus
Diaporthe Nitschke (1870) (asexual state
Phomopsis (Sacc.) Bubák) includes hundreds of species.
Diaporthe species are widespread and they are non-pathogenic endophytes (biotrophic fungi), saprotrophs, and fungal pathogens of many plants and even mammals
[9,10][1][2].
Phytopathogenic
Diaporthe species have been intensively studied, especially those affecting economically important crops, such as soybean, sunflower, grapes, citrus, and fruit, and ornamental trees
[11][3]. Diseases caused by
Diaporthe spp. on soybean are stem canker, pod and stem blight, and seed decay (
Table 1)
[7,12,13][4][5][6].
Morphological evaluation of fungal growth from surface sterilized soybean seeds plated on acidified potato dextrose agar (APDA) is still common in the identification of
Diaporthe spp.
[14][7]. However, because of strong similarities and overlaps in shapes and colors of cultures and in conidial size, delimitation of
Diaporthe spp. is not valid just based on morphology
[8,9,10][1][2][8]. Species diversity in the genus
Diaporthe was explored by assays using PCR
[8,15,16][8][9][10]. The nuclear ribosomal internal transcribed spacer (ITS) can be used for discrimination of
Diaporthe spp.
[17,18,19][11][12][13]. The primers Phom.I and Phom.II were designed on the ITS sequences of
D. phaseolorum and
D. longicolla for the detection of many
Diaporthe spp.
[15][9]. The primers DphLe and DphRi were developed for detection of
D. aspalathi [20][14]. There are also real-time (q)PCR assays based on ITS to detect and quantify
Diaporthe spp. on soybean. The first was developed by Zhang et al.
[21][15]. The TaqMan primer-probe sets PL-3, PL-5, and DPC-3 were designed for
D. longicolla,
D. aspalathi,
D. caulivora, and
D. sojae. For additional information on the mentioned primers and assays, see
Table 1.
Table 1.
Primers and corresponding assays for the diagnosis of
Diaporthe
spp. on soybean.
However, ITS sequence data alone are not sufficient to resolve all
Diaporthe species
[23,24][17][18]. Therefore, translation elongation factor 1-α (
TEF1), beta-tubulin (
TUB), calmoduline (
CAL), histone-3 (
HIS), and large ribosomal subunit (
LSU) are also used to differentiate
Diaporthe species
[25,26,27][19][20][21].
Recently, the TaqMan primer-probe sets DPCL, DPCC, DPCE, and DPCN were designed based on
TEF1 to identify, discriminate, and quantify
D. longicolla,
D. caulivora,
D. eres, and
D. novem simultaneously in a quadruplex real-time PCR
[22][16].
In a study on expression of soybean defense-related genes, the
TUB-based primers DPM were used with SYBR
® Green real-time PCR to detect and quantify
D. aspalathi in soybean tissues
[28][22]. The same assay was also used to quantify the fungal biomass in soybean stems infected with
D. caulivora [29][23].
There are additional PCR assays for the identification of
Diaporthe spp.: random amplified polymorphic DNA (RAPD), PCR-restriction fragment length polymorphism (RFLP), and amplified fragment length polymorphism (AFLP) have been used to distinguish
Diaporthe species
[15,16,30,31,32][9][10][24][25][26]. The species
D. caulivora,
D. aspalathi, and
D. sojae could only be defined after finding differences between the
D. phaseolorum varieties
caulivora,
meridionalis, and
sojae using RAPD
[30][24]. After that, PCR-RFLP was used to distinguish
D. longicolla,
D. caulivora,
D. aspalathi, and
D. sojae [15][9].
2. Genus Sclerotinia
Sclerotinia sclerotiorum (Lib.) de Bary is among the most destructive plant pathogens. It is the only relevant pathogen of the genus
Sclerotinia on soybean. This fungus can infect over 400 species of plants, including sunflower, soybean, and oilseed rape
[33][27]. On soybean
S. sclerotiorum causes white mold, which reduces yield by more than 40% in wet and mild weather
[34][28]. Since the pathogen disseminates via seeds, sowing seeds with certified health quality is the first step to avoid this disease.
Molecular detection has been established independently more than once. Primers SSFWD/SSREV were designed for the identification of
S. sclerotiorum [35][29] and the specificity and sensitivity of these primers were confirmed experimentally by performing PCR and real-time (q)PCR (SYBR Green) using the touchdown method, to distinguish
S. sclerotiorum isolates from
Aspergillus,
Cercospora,
Colletotrichum,
Corynespora,
Fusarium,
Macrophomina,
Diaporthe, and
Botrytis species
[36][30]. Other primers were used to identify
S. sclerotiorum ascospores and detect
S. sclerotiorum in infected plant tissue
[37,38,39][31][32][33]. When tested on soybean seeds inoculated with
S. sclerotiorum, these primers were not useful
[36][30]. Variability among isolates from this species from different regions or hosts can lead to these differences. In a separate study, the primer pair SSFWD/SSREV
[35][29] was tested to detect
S. sclerotiorum in inoculated and in naturally infected soybean seeds using the seed soaking procedure
[34][28]. Since the ITS region did not allow for fully reliable diagnosis the mitochondrial small rRNA and SS1G_00263, coding for a hypothetical secreted protein was used
[39,40][33][34]. For additional information on the mentioned primers and assays, see
Table 2.
3. Genus Colletotrichum
The ascomycete genus
Colletotrichum is quite large, with more than 200 species. Some of the species are clearly defined, but there also are several species complexes
[41,42,43][35][36][37].
Colletotrichum spp. are causal agents of anthracnose in more than 3000 plant species and are among the top 10 fungal pathogens
[44,45,46][38][39][40].
C. truncatum,
C. destructivum,
C. coccodes,
C. chlorophyte,
C. gloeosporioides,
C. incanum,
C. plurivorum,
C. sojae,
C. musicola, and
C. brevisporum can all cause anthracnose on soybean
[42,47,48,49,50,51,52,53,54][36][41][42][43][44][45][46][47][48]. Among those species
C. truncatum is the most notorious
[47][41] and there is relatively little information about the other species infecting soybean. Phylogenetic resolution is still in progress, with many studies addressing the issue
[41,42,43,44,55,56,57,58,59,60][35][36][37][38][49][50][51][52][53][54].
Variation in the ITS region is not sufficient to discriminate all species, so Glyceraldehyde-3-Phosphate Dehydrogenase (
GAPDH),
TUB2,
CHS-1, and
ACT are used along with ITS, also when using with the soybean pathogens
[42,55][36][49]. Among those
GAPDH is most informative, at least for distinguishing the most important pathogen
C. truncatum [61][55]. Based on ITS, three primers were designed and used to distinguish
C. gloeosporioides and
C. truncatum on soybean by performing classical multiplex-PCR
[62][56]. The intergenic spacer (IGS) has been used as an alternative to ITS. An advantage is that it contains more polymorphic sites. It was efficiently used for detecting
C. lupini in lupins by PCR and can be considered an alternative target for
Colletotrichum species
[63][57].
A multiplex TaqMan qPCR assay targeting the
GAPDH gene was developed to detect and quantify
C. truncatum along with
Corynespora cassiicola and
S. sclerotiorum in soybean seeds
[64][58]. A multiplex qPCR assay targeting the
cox1 gene has also been established to distinguish the four soybean-infecting
Colletotrichum species
C. chlorophyti,
Glomerella glycines (
Colletotrichum sp.),
C. incanum, and
C. truncatum, by using two duplex sets. Successful detection was achieved with 0.1 pg of
C. truncatum DNA, but when published, the assay had not yet been tested on host tissue samples
[65][59].
For some
Colletotrichum species that can infect soybean, diagnostic assays were developed because of damages on other host plants. These are
C. acutatum on strawberries and grapevines
[66,67][60][61],
C. coccodes in soil and on potato tubers
[68][62],
C. kahawae on coffee
[69][63], and
C. lagenarium on cucurbit crops
[70][64]. These assays may be transferred and used for diagnostics on soybean, too.
In addition to PCR and real-time PCR also LAMP (loop-mediated isothermal amplification) assays were established to detect
C. truncatum, targeting the large subunit of RNA polymerase II (
Rpb1) coding gene
[71][65], and
C. gloeosporioides, for which the target gene was a glutamine synthetase (
GS)
[72][66]. While these assays offer the advantage of diagnosis directly on the field because no PCR cycler is necessary and the reaction can be observed directly without any equipment, they are an order of magnitude less sensitive than the corresponding real-time PCR assays. For additional information on the mentioned primers and assays, see
Table 3.
The causal agent of SDS,
F. solani (Mart.) Sacc. f. sp.
glycines [86][81], was first identified in 1989
[87,88][82][83]. At first, its identification has relied on morphological characteristics, which did not fully resolve the species complex. Using nuclear ribosomal DNA sequences of species within the
F. solani complex, SDS-causing isolates were identified and
F. solani f. sp.
phaseoli was defined
[82][77]. However, non-SDS-causing isolates are still included within
F. solani f. sp.
phaseoli. Another study using RAPD, could show that SDS-causing isolates form a cluster representing a biological subgroup within
F. solani f. sp.
phaseoli, and the authors suggested that it represents a separate
forma specialis [89][84]. The differences between
F. solani f. sp.
glycines causing SDS and other
F. solani are important for specific identification and detection. Differences in the
mtSSU rRNA gene can be used to distinguish isolates of
F. solani [83][78]. Detection of
F. solani f. sp.
glycines from plant and soil samples was enabled by a PCR assay using primers based on
mtSSU and
TEF1 [83,90][78][85].
Two TaqMan probe qPCR assays for quantification of
F. virguliforme from soybean plant samples based on
mtSSU sequences are available
[91,92][86][87]. Due to similarities in the
F. solani species complex, the mitochondrial DNA (mtDNA) region is too conserved to differentiate
F. virguliforme from the dry bean root rot pathogens
F. cuneirostrum and
F. phaseoli and other SDS causal agents, such as
F. tucumaniae,
F. crassistipitatum, and
F. brasiliense, which dominate in South America
[93,94][88][89]. However, the IGS region of the rDNA can resolve
F. virguliforme from the other closely related
Fusarium species, as demonstrated in multilocus genotyping studies of clade 2
F. solani species
[93,94][88][89]. Following this, a TaqMan primer/probe set based on IGS to detect and quantify
F. virguliforme in field-grown soybean roots and soil was established
[95][90]. The
FvTox1 gene was also used to distinguish
F. virguliforme from the other species within the SDS-BRR (bean root rot) clade in soil and soybean root samples with a species-specific TaqMan real-time qPCR assay
[96][91].
Since the assay based on the
FvTox1 gene has a much higher limit of detection than assays based on the rDNA, yet another assay specific for
F. virguliforme was developed, based on the IGS region
[97][92]. This primer/probe set was later also used in a duplex qPCR assay for simultaneous detection of
F. virguliforme and
F. brasiliense [98][93]. Most recent (to our knowledge, 2022) is a series of primer/probe sets to detect
F. acuminatum,
F. graminearum,
F. proliferatum, and
F. solani, based on
TEF1 and
F. oxysporum, and
F. equiseti, based on IGS
[99][94]. In this case, there are limits in specificity, especially of the
F. solani primers/probe set (Fsol), which also amplifies
F. graminearum,
F. equiseti, and
F. virguliforme, though much later than
F. solani. For additional information on the mentioned primers and assays, see
Table 4.
102][97] and causes membrane damage and cell death
[105][100]. Cercosporin production is regulated by CFP (Cercosporin Facilitator Protein), which is specific for the genus and encoded by the gene
cfp [106][101].
Seven nuclear gene regions and the mitochondrial (
cyb) gene region were evaluated to study
Cercospora species phylogenetically
[107][102]. The seven regions included
ACT,
CAL,
HIS, ITS, and
TEF1, which were used in previous studies
[108,109,110,111][103][104][105][106]. In addition, two primer pairs were designed based on
cfp of
C. kikuchii and one new primer Ck_Betatub-F1 to amplify
tub-1 after the complete
TUB from
C. beticola was analyzed
[107][102].
TUB and
cfp are excellent sources for polymorphic markers to investigate the relationships between the CLB and PSS pathogens.
The CNCTB6F/CNCTB6F primer pair, which targets the NADPH-dependent oxidoreductase gene (
CTB6) from
C. nicotianae [112][107], can be used to detect
C. kikuchii and to differentiate between
C. kikuchii and
C. sojina [113][108]. The ITS1 and ITS2 sequences of genus
Cercospora are too similar to develop primers for species-specific detection
[113][108]. Therefore, a TaqMan real-time PCR assay was developed based on the
CTB6 gene to detect
C. kikuchii [113][108] (
Table 5).
4. Genus Fusarium
Multiple
Fusarium species are among the most important phytopathogenic and mycotoxigenic fungi
[73,74][67][68]. Several
Fusarium species are associated with soybean, causing
Fusarium blight/wilt (
F. oxysporum), sudden death syndrome (SDS,
F. virgiliforme formerly
F. solani f. sp.
glycines), and root rot and seedling diseases (several
Fusarium spp.)
[1,75,76,77,78,79,80][69][70][71][72][73][74][75]. Diagnosis of the root pathogens may be difficult because they may either be the primary pathogen or infect together with other soilborne fungi (e.g.,
Macrophomina,
Phytophthora,
Pythium, and
Rhizoctonia)
[76,81][71][76].
Fusarium species have some differences in their housekeeping genes, and molecular identification has been widely used. Relevant genes for this genus are
TEF1,
TUB, mitochondrial small subunit rDNA (
mtSSU), 28S rDNA, ITS, and IGS
[82,83,84,85][77][78]
5. Genus Cercospora
Two species of genus
Cercospora can infect soybeans.
C. kikuchii (T. Matsumoto and Tomoy; M. W. Gardner) causes Cercospora leaf blight (CLB) and purple seed stain (PSS), while Frogeye leaf spot is caused by
C. sojina Hara
[1,100,101][69][95][96]. Production of a red toxin called cercosporin by
C. kikuchii is recognized as a pathogenicity factor during colonization of soybean seeds and other aerial parts of the plant, including leaves, petioles, stems, and pods
[102,103,104][97][98][99]. Cercosporin is also responsible for the symptoms of PSS: presence of purple spots against the natural color of the soybean seed coat
[
6. Genus Septoria
Septoria glycines Hemmi causes Septoria brown spot, a foliar disease on soybean
[1][69]. The pathogen infects pods and seeds but is rarely transmitted by seeds
[114][109]. Early in the season, the symptoms are similar to those of bacterial blight (
Pseudomonas syringae pv.
glycinea)
[115,116][110][111]. Later in the season,
Septoria brown spot occurs together with frogeye leaf spot (
Cercospora sojina) and
Cercospora leaf blight (
C. kikuchii)
[117][112], making molecular diagnosis especially useful.
Three primers/probe sets were developed for qPCR based on
ACT,
TUB, and
CAL [118][113]. The
CAL set was not as specific as anticipated. The
ACT set (
Table 6) was specific to
S. glycines for both conventional PCR and qPCR and the
TUB set was specific only in qPCR.
7. Genus Macrophomina
The species in genus
Macrophomina that is relevant to soybean is
Macrophomina phaseolina (Tassi) Goid. This is one of the most severe soil and seed borne pathogens, attacking a wide range of hosts
[119][114]. The fungus causes damping off, seedling blight, collar rot, stem rot, charcoal rot, and root rot diseases in various crops
[120][115]. In soybean,
M. phaseolina causes charcoal rot.
There is sequence variation between isolates of
M. phaseolina. There have been several attempts to correlate this variation in several genetic markers with sampling region and host plant association, but while some groups found correlations
[121][116], other publications could not
[122[117][118][119],
123,124], so that no
forma speciales for soybean or another host plant have been defined, yet.
Consequently, the molecular detection assays that were established so far aim to detect all strains of
M. phaseolina. In one approach that targets the ITS, the authors made sure to find primers on regions in the ITS that are conserved among
M. phaseolina isolates, but different from other species
[125][120]. The other approach to find a sequence conserved among
M. phaseolina isolates was the sequence characterized amplified regions (SCAR) method. Using the universal rice primer URP-9F, a PCR product could be obtained that was the same for all
M. phaseolina isolates and the resulting sequence (gene of unknown function) was used to design primers and probe for qPCR, enabling either SYBR green based or probe based qPCR
[126][121]. A LAMP assay for detection of the species also uses the ITS sequence
[127][122]. For additional information on the mentioned primers and assays, see
Table 7.
8. Genus Phialophora
Brown stem rot (BSR) is a vascular disease caused by the soil-borne fungus
Phialophora gregata f. sp.
sojae (Allington and Chamberlain) Gams. This pathogen has two genotypes, “A” and “B”
[128][123]. Genotypic differences among isolates correspond to phenotypic differences in the type and severity of symptoms. Isolates of genotype “A” are more aggressive than isolates of genotype “B”
[129,130][124][125]. Genotypes “A” and “B” differ by a 188-bp insertion/deletion (INDEL) in the IGS of the ribosomal DNA and they also display cultivar preference
[131,132,133][126][127][128].
Primers based on ITS were developed to identify
P. gregata in infected soybean stems
[134][129]. This primer pair was also used in combination with primer pair Plect1/Plect2 specific for
Plectosporium tabacinum, to differentiate these two pathogens, which are associated with BSR
[135][130]. Once the IGS region was found useful to distinguish “A” and “B”, primers BSRIGS1 and BSRIGS2 were designed
[131][126]. In 2007, a qPCR assay was developed to quantify
P. gregata f. sp.
Sojae in plant tissue and in soil
[136][131]. This qPCR assay does not yet distinguish between genotypes “A” and “B”. In 2009, a qPCR to specifically detect genotype “A” was developed. In combination with a specific primer/probe set
[136][131], genotype “B” can also be quantified by determining the difference between the total
P. gregata f. sp.
sojae DNA amount and that of genotype “A”
[137][132]. For additional information on the mentioned primers and assays, see
Table 8.
9. Genus Rhizoctonia
Rhizoctonia solani Kühn (Teleomorph:
Thanatephorus cucumeris (Frank) Donk) is a soil-borne fungal pathogen.
R. solani is a species complex that was subdivided into anastomosis groups (AGs) based on an assessment of hyphal fusions
[138,139][133][134]. AGs are subdivided into subgroups based on cultural morphology and physiological characteristics
[140][135]. There are “13 AGs with 14 subgroups”
[140,141,142][135][136][137]. The AGs vary in morphology, pathogenicity, and susceptibility to fungicides
[143][138]. AG 1 to 4 cause disease in several economically important crops
[138][133]. The other groups have more restricted host ranges or are less important. AG 12 is a special case: it forms mycorrhiza
[141][136]. Molecular phylogenies have confirmed the AGs and the nomenclature was kept, even though the AGs may represent different species. The AGs important for soybean are AG 1-IA and AG 1-IB
[1][69].
PCR detection assays were established for most of the AGs. Here, we present the assays for AG 1-IA and AG 1-IB. An assay based on ITS to detect AG 1-IA, AG 1-IB, and other AGs was designed in 2002
[144][139]. Later, two other groups
[145,146][140][141] reported additional assays for the two AGs, respectively. As part of a real-time PCR study to detect and discriminate 11 AGs of
R. solani using ITS regions, AG 1-IA was also detected
[147][142]. In 2015, a LAMP assay was developed to detect
R. solani in infected soybean tissues in the field
[127][122]. For additional information on the mentioned primers and assays, see
Table 9.
[149][144]. The two species may be confused and early symptoms can be confused with bacterial pustule
[1][69]. Therefore, molecular diagnosis of the soybean rust has been established. The ITS region has more than 99% nucleotide sequence similarity among different isolates of either
P. pachyrhizi or
P. meibomiae, but only 80% between the two species. Using the differences within the ITS region, four sets of primers were designed for
P. pachyrhizi (Ppa1/Ppa2, Ppa3/Ppa4, Ppm1/Ppa2, and Ppm1/Ppa4) and two sets for
P. meibomiae (Pme1/Pme2 and Ppm1/Pme2). The primers were tested and Ppm1/Ppa2 used as specific for
P. pachyrhizi and Ppm1/Pme2 for
P. meibomiae [150][145]. A VIC-labeled probe and the primers Ppm1/Ppm2 were designed as specific for genus
Phakopsora.
P. pachyrhizi urediospores are wind-dispersed and, apart from diagnosis on plants, detection of spores in the air can be useful to predict epidemics or for scouting efforts. For this, the assay described above and another assay
[151][146] were tested for sensitivity and from these assays another nested assay was created with a newly designed TaqMan probe (ITS1PhpFAM1). The nested assay combines the reverse primer Ppa2 specific to
P. pachyrhizi [150][145] and a more general rust fungal forward primer ITS1rustF4a in the first round. In the second round ITS1rustF10d and ITS1rustR3d are combined with the probe. The assay can detect single and so is sensitive enough to find spores deposited in rain
[152][147]. For additional information on the mentioned primers and assays, see
Table 11.
10. Genus Phakopsora
Soybean rust (SBR) is considered the economically most important disease on soybean. SBR is caused by two closely related fungi,
Phakopsora pachyrhizi and
P. meibomiae [148,149][143][144].
P. pachyrhizi, also called Asian soybean rust (ASR) since it originates from East Asia, is more aggressive and causes considerably greater yield loss
11. Genus Phytophthora
Phytophthora sojae (Kaufm. and Gerd.) causes seed decay, root rot, damping off that may occur before or after emergence, stem rot, and sometimes foliar blight
[153][148]. Soybean is the only major host of
P. sojae [154][149]. Another Phytophthora species,
P. sansomeana, has been isolated since 1981 from soybean in the USA and China
[155,156,157,158,159][150][151][152][153][154].
The first target for molecular diagnosis was the ITS region. One PCR assay developed for
P. sojae utilized primers PS1/PS2
[160][155]. The primers were also used in a SYBR-green based qPCR assay with a 10 pg limit of detection. Another group using the primers found problems with discrimination against other
Phytophthora species from soybean
[161][156]. Consequently, they developed their own PSOJF1/PSOJR1 primers, also targeting the ITS region
[162][157]. Other researchers
[163][158] using these primers reported a limit of detection of 10 fg in absolute quantifications. Other targets described for
P. sojae detection are a Ras-related protein (
Ypt1) coding gene
[164][159] and an
A3aPro transposon-like element
[165][160].
A hierarchical approach to
Phytophthora genus- and species-specific qPCR assays based on mitochondrial genes
[166][161] provides new targets. Here, two loci were used, one for detecting all
Phytophthora spp., the tRNA locus (
trnM-trnP-trnM), and another,
atp9, and the spacer between
atp9 and
nad9 (
atp9-nad9) for genus- and species-specific detection. This approach was utilized to design specific probes for many
Phytophthora spp.
[167][162]. The system was also adapted for the isothermal technique recombinase polymerase amplification (RPA)
[168][163]. Building on these approaches, a diagnostic assay for
P. sojae and
P. sansomeana was developed
[169][164]. Using a genus specific probe and probes specific to
P. sojae and
P. sansomeana this multiplex qPCR assay can simultaneously determine if a sample is infected by any
Phytophthora spp. and if it contains either
P. sojae,
P. sansomeana, or both
[169][164]. The assay is highly specific and sensitive. A plant mitochondrial internal control for quantification relative to soybean and to determine the presence of PCR inhibitors can also be included in the assay. Another artificial internal control can be added when testing soil samples. Primer sets for RPA also exist
[169][164].
Other groups
[170,171][165][166] used the
Ty3/Gypsy retroelement as target. This transposable element is widely distributed in the
Phytophthora genus and forms lineages that predate the separation of the species
[172][167]. This sequence is a good target because it is present in all isolates and has multiple copies per genome. Primers PS12 and PS6R were developed for this sequence and produced a 282 bp amplicon in all
P. sojae isolates, but not on other
Phytophthora spp. and other fungal soybean pathogens, as well as soybean itself
[170][165]. This was developed into a probe-based qPCR assay for
P. sojae [171][166]. For additional information on the mentioned primers and assays, see
Table 11.
Table 11.
Primers and corresponding assays for diagnosis of
Phytophthora
spp. on soybean.
| Target Gene |
Target Species (Specificity) |
Primer/Probe (Combination) |
Sequence (5′-3′) |
T | m | (°C) |
Fragment Length (bp) |
Assay |
Ref. |
| ITS |
P. sojae | | a |
PS1 |
CTGGATCATGAGCCCACT |
66 |
330 |
PCR/qPCR | b |
[160] | [155] |
| PS2 |
GCAGCCCGAAGGCCAC |
| ITS |
P. sojae |
PSOJF1 |
GCCTGCTCTGTGTGGCTGT |
50 |
127 |
qPCR | b |
[162] | [157] |
| PSOJR1 |
GGTTTAAAAAGTGGGCTCATGATC |
| Ypt1 |
P. sojae |
F3 |
CCTTGTCTGCCCTCTCGA |
65 | b |
|
LAMP |
[164] | [159] |
| B3 |
AGAAGCGTACACCCACCA |
| FIP |
GAATTTTCTGGGCGGGACAACGCCAGGATGGCTAAGGTTTCC |
| BIP |
GAGCTGGACGGCAAGACCATCCATAAGTGCGCTTAACCGG |
| LF |
GCACAATATTGTCAGCAACTGGATC |
| LB |
CAAGCTCCAGATTGTACGTTCA |
| A3aPro |
P. sojae |
F3 |
GCGTATTGAGGGTTGCTG |
64 | c |
|
LAMP |
[165] | [160] |
| B3 |
GCGTCCTATCACCTAGTGC |
| FIP |
ACGTGGGTTCGGATTGGACC-CTTGGGTACTGTGTACCAG |
| BIP |
CGCCACCGATGATTCGACGA-AATCAACCATCACTCACCG |
| LB |
GTAGGATGATTGGATGAACAC |
| atp9 |
Phytophthora |
PhyG_ATP9_2FTail |
AATAAATCATAACCTTCTTTACAACAAGAATTAATG |
57 |
|
multiplex qPCR |
[166,169] | [161][164] |
| nad9 |
PhyG-R6_Tail |
AATAAATCATAAATACATAATTCATTTTTATA |
| atp9-nad9 |
Phytophthora genus-specific TaqMan probe |
FAM-AAAGCCATC [ZEN] ATTAAACARAATAAAGC-IABkFQ |
| atp9-nad9 |
P. sojae |
P. sojae species-specific TaqMan probe |
HEX-TTGATATAT [ZEN] GAATACAAAGATAGATTTAAGTAAAT-IABkFQ |
| atp9-nad9 |
P. sansomeana |
P. sansomeana species-specific TaqMan probe |
Quasar670-TATTAGTACTAAYTACTAATATGCATTATTTTTAG-BHQ-2 |
| tRNA-M |
Phytophthora |
TrnM-F |
ATGTAGTTTAATGGTAGAGCGTGGGAATC |
39 | d |
|
RPA |
[168,169] | [163][164] |
| TrnM-R |
GAACCTACATCTTCAGATTATGAGCCTGATAAG |
| TrnM-P |
TAGAGCGTGGGAATCATAATCCTAATGTTG [FAM-dT] A [THF] G [BHQ1-dT] TCAAATCCTACCATCAT [3′-C3SPACER] |
| atp9 |
|
Atp9-F |
CCTTCTTTACAACAAGAATTAATGAGAACCGCTAT |
| atp9-nad9 |
P. sojae |
Psojae-nad9-R |
TTAAATCTATCTTTGTATTCATATATCAA |
| P. sansomeana |
Psan-nad9-R |
TTAGTAGTTAGTACTAATATAACAAAAATATAATA |
| atp9 |
|
Atp9-P |
TTGCTTTATTYTGTTTAATGATGGCWTTY (T-FAM) T [THF] A (T-BHQ1) YTTATTTGCTTTTT [3′-C3SPACER] |
| Ty3/Gypsy | retroelement |
C. truncatum |
Pso12-F |
CAGGTTTTCAGCGATCTCATCCAAGTG |
60 |
282 |
qPCR |
[171] | [166] |
| Pso6-R |
CACATTGCGGAAAAGGAGGTGATTGCT |
| Pso-P5 |
FAM-TGCCGACTGCGAGGTCAGCAACCACTTCAA-IBFQ |