Submitted Successfully!
To reward your contribution, here is a gift for you: A free trial for our video production service.
Thank you for your contribution! You can also upload a video entry or images related to this topic.
Version Summary Created by Modification Content Size Created at Operation
1
Fernando Carton
 + 819 word(s) 819 2021-03-25 05:29:12 |
2 update layout and reference
Rita Xu
 + 2952 word(s) 3771 2021-03-31 11:45:23 |

Video Upload Options

Do you have a full video?
Send video materials Upload full video

Confirm

Are you sure to Delete?
Yes No
Cite
If you have any further questions, please contact Encyclopedia Editorial Office.
Carton, F. Oligonucleotide-Based Therapies. Encyclopedia. Available online: https://encyclopedia.pub/entry/8392 (accessed on 20 April 2024).
Carton F. Oligonucleotide-Based Therapies. Encyclopedia. Available at: https://encyclopedia.pub/entry/8392. Accessed April 20, 2024.
Carton, Fernando. "Oligonucleotide-Based Therapies" Encyclopedia, https://encyclopedia.pub/entry/8392 (accessed April 20, 2024).
Carton, F. (2021, March 31). Oligonucleotide-Based Therapies. In Encyclopedia. https://encyclopedia.pub/entry/8392
Carton, Fernando. "Oligonucleotide-Based Therapies." Encyclopedia. Web. 31 March, 2021.
Oligonucleotide-Based Therapies
Edit
This entry is adapted from the peer-reviewed paper 10.3390/biomedicines9030303

The global burden of chronic kidney disease (CKD) is increasing every year and represents a great cost for public healthcare systems, as the majority of these diseases are progressive. Therefore, there is an urgent need to develop new therapies. Oligonucleotide-based drugs are emerging as novel and promising alternatives to traditional drugs. Their expansion corresponds with new knowledge regarding the molecular basis underlying CKD, and they are already showing encouraging preclinical results, with two candidates being evaluated in clinical trials. However, despite recent technological advances, efficient kidney delivery remains challenging, and the presence of off-targets and sideeffects precludes development and translation to the clinic.

chronic kidney disease kidney oligonucleotide therapeutics kidney delivery nanocarrier nanoparticle

1. Introduction

Recent studies have estimated that chronic kidney diseases (CKDs) affect around 850 million people worldwide (one in ten adults). The global burden of CKD is increasing and is projected to become the fifth most common cause of years of life lost globally by 2040 [1]. Since CKD is mostly irreversible and progressive, patients who advance to end-stage renal disease (ESRD) require dialysis or renal transplantation, which negatively affect quality of life and have a large impact on healthcare systems. It has been estimated that the costs of dialysis and transplantation consume 2–4% of annual healthcare budgets in high-income countries [1][2]. Moreover, kidney transplantation is associated with a high risk of morbidity and mortality, after rejection, infections, and cancer development, as a consequence of the continuous immunosuppression required [3]. Therefore, kidney disease has a major effect on global health and deserves greater attention for the development and improvement of new detection methods and treatments.

Oligonucleotide (ON) therapeutics, such as those based on antisense oligonucleotides (ASOs), small interfering RNA (siRNA), microRNA (miRNA), aptamers, and decoys, are promising agents that have gained importance during the last decades. As of January 2020, ten oligonucleotide drugs have received regulatory approval from the United States Food and Drug Administration (FDA) and dozens are under clinical trials [4][5]. However, a major obstacle that still hampers the development of new oligonucleotide-based therapies is the difficulty in directing them to specific organs. The kidneys are highly vascularized organs that receive up to 25% of cardiac output, and are susceptible to targeting by most systemic administration routes. Additionally, the glomerular filtration barrier has evolved to filter molecules smaller than 50 kDa in size, which includes the majority of oligonucleotides commonly used in therapeutics, allowing their access to the tubular epithelium. However, this route mostly favors targeting of the liver and other peripheral organs, such as the spleen, due to its vascularized anatomy and scavenging functions. Indeed, at least half of the approved oligonucleotide-based drugs have been developed for liver therapy [4][5]. The unresolved problem of non-specific and off-target effects is a second major obstacle yet to be overcome by improving delivery methods. Importantly, toxicity, and side-effects of oligonucleotides have already been described, including inhibition of unspecific genes, oversaturation of the endogenous small RNA processing pathways, or non-complementary binding of the oligonucleotide to unintended RNAs with a sequence similar to the target RNA [6][7][8][9][10].

2. Oligonucleotides Used in Therapeutics

Oligonucleotide therapies have received considerable attention in recent years, mainly because of their advantages over conventional treatments. Contrary to traditional small molecule drugs, which typically combat disease pathology by modulating the downstream pathways of a disease-causing gene, oligonucleotide-based therapies may directly modify the gene encoding intermediates at fault by targeting DNA or mRNA precursors. Therefore, ONs can also be effective against a wide variety of targets, including proteins and posttranslational protein modifications, carbohydrates, lipids, and metabolites, by directly targeting them with aptamers, or by modulating gene expression. Their versatility is derived from their simple structure, easy synthesis, and the possibility of a rational design. In contrast to conventional drugs that are usually limited to binding specific protein pockets or active sites, DNA and RNA targeting is mostly based on sequence recognition or the presence of unique three-dimensional conformations that allow ONs to potentially bind any target molecule [11][12]. To date, many different oligonucleotide-based therapeutic strategies have been designed, including both DNA and RNA ONs. However, the active roles that RNAs play in cell biology and metabolism, together with our increasing understanding of their role in gene expression and endogenous regulatory machinery, make RNA-based therapeutics the preferred option for their use in medicine [13].

One of the major drawbacks of using extra-cellular oligonucleotides, especially those based on RNA, is their susceptibility to degradation by nucleases and poor pharmacokinetics. To overcome these limitations, such drugs often include chemical modifications of their backbone and nucleobases that increase stability, enzymatic resistance, and efficacy, which will be explained in further detail in the next chapter of this review. A notable advantage of targeting the kidney is that oligonucleotide therapies are rapidly cleared from the circulation via renal filtration, favoring their biodistribution in the kidney over other organs [14]. Here, we will outline the main strategies employed in the development of oligonucleotide-based therapies and the most recent advances for their use in renal diseases, which are also summarized in Table 1.

Table 1. Summary of preclinical studies targeting the kidney with oligonucleotide-based therapies.

STRATEGY REFERENCE RENAL TARGETS
(Target; Cell/Tissue Type; Animal Model)		 SEQUENCE (5′-3′) CARRIER AND ROUTE OF ADMINISTRATION
siRNA Molitoris et al., 2009 [15] Trp53; PTECs; cisplatin-induced and ischemic AKI models in rats GAAGAAAAUUUCCGCAAAA Naked; IV
Takabatake et al., 2009 [16] Egfp and Tgfb1; glomeruli; glomerulonephritis model in rats Egfp—GGCUACGUCCAGGAGCGCA
Tgfb1—GUCAACUGUGGAGCAACACdTdT		 Naked, RA
Shimizu et al., 2010 [17] Mapk1; glomeruli; glomerulonephritis model in mice and rats UGCUGACUCCAAAGCUCUGdTdT Polyion complex nanocarriers; IP
Gao et al., 2014 [18] Aqp1; PTECs; mice CGCAACUUCUCAAACCACUTT Chitosan NPs; IV
Morishita et al., 2014 [19] Smad4; tubulointerstitium and tubule epithelial cells; renal fibrosis model in mice GAUGAAUUGGAUUCUUUAATT Naked; IV
Yang et al., 2015 [20] Cox2; peritoneal macrophages recruited to the kidney; UUO model in mice GGAUUUGACCAGUAUAAGUTT Chitosan NPs; IP
Zuckerman et al., 2015 [21] Egfp; glomerular mesangium; mice GGCUACGUCCAGGAGCGCACC Polycationic cyclodextrin NPs functionalized with mannose and transferrin; IV
Zheng et al., 2016 [22] Fas, C3 and RelB; glomeruli and medullar tubule cells; ischemic AKI in mice Fas—GUGCAAGUGCAA ACCAGAC
C3—GUGCAAGACUUCCUAAAGA
RelB—GGAAUCGAGAGCAAACGAA		 Naked; RA
Alidori et al., 2016 [23] Ctr1, Trp53 and Mep1b; cortex and PTECs; AKI model in mice Ctr1—GGCAUGAACAUGUGAAUUGCUGGTT
Trp53—AGGAGUCACAGUCGGAUAUCAGCCT
Mep1b—GGAAUUGACCAAGACAUAUUU GATA		 Fibrillar carbon nanotubes (fCNT); IV
Eadon et al., 2017 [24] Lrp2; PTECs, mice   Naked or lipid-base transfection; IV
Narváez et al., 2019 [25] Cd40; tubulointerstitium; UUO model in mice GUGUGUUACGUGCAGUGACUU Naked; IV
Wang et al., 2020 [26] p38α MapK and p65; glomerular mesangium and peritubular endothelial cells; glomerulonephritis model in mice p38α—GGUCACUGGAGGAAUUC
p65—GCGACAAGGUGCAGAAAGA		 Liposomal NPs, IV
Thai et al., 2020 [27] Trp53; tubular epithelial cells; AKI model in mice GAGAAUAUUUCACCCUUCA DNA nanostructure; IV
shRNA plasmid Wang et al., 2006 [28] Mr; cortical tubule cells; renal hypertension and damage model in rats CCAACAAGGAAGCCTGAGC AAV; IV
Shou et al., 2009 [29] Sharp2; T-cells; transplantation model in rats ACCCGAACATCTCAAACTTA Lentivirus; ex vivo perfusion
Zhou et al., 2011 [30] ColI; cortex; rats GCAACCTGGATGCCATCAA Lentivirus; RP
Fujino et al., 2013 [31] Trp53: cortex and medullar tubule cells; ischemic AKI model in mice   Cationic polymer; RA
Espana-Agusti et al., 2015 [32] Tsc1 and Luc; PTECs, DTECs and interstitium; mice Tsc1—CGGAAGAAGCTGCAATATCTAA
Luc—CCGCCTGAAGTCTCTGATTAA		 Lentivirus; RP
Xu et al., 2020 [33] Yap and Klf4; renal tubules; ischemic AKI model in mice   Adenovirus; RP
saRNA Zeng et al., 2018 [34] Trpv5; medullar tubule cells; calcium crystal formation model in rats AAGGGTCTCATGATTTCTCTA Naked; RU
miRNA antagomir Chau et al., 2012 [35] miR21; PTECs; UUO model in mice   Naked; IP
Putta et al., 2012 [36] miR192; cortex and glomeruli; DN model in mice GGCTGTCAATTCATAGGTCAG Naked; SC
Li et al., 2014 [37] miR204; cortex and medulla; candidemia-induced AKI model in mice AGGCAUAGGAUGACAAAGGGAA Naked; IV
Gomez et al., 2015 [38] miR21; PTECs, Alport nephropathy mouse model   Naked, SC
Wang et al., 2017 [39] miR107; peritubular endothelial cells; septic AKI model in mice   Complexed with atelocollagen; IV
Wilflingseder et al., 2017 [40] miR182-5p; cortex and medulla; ischemic AKI model in mice, rats and pigs   Naked; IV (mice and rats), ex vivo perfusion (pig)
Wei et al., 2016 [41] miR489; tubular epithelial cells; ischemic AKI model in mice   Naked; IV
Wei et al., 2018 [42] miR668; tubular epithelial cells; ischemic AKI model in mice   Naked; IV
Lee et al., 2019 [43] miR17; PTECs; ADPKD mouse model GUUUCACGA Naked; SC
Luan et al., 2020 [44] miR150; cortex and medulla; renal fibrosis model in mice UACAAGGGUUGGGAG Naked; IV
miRNA mimic Li et al., 2014 [37] miR204 and miR211; cortex and medulla; candidemia-induced AKI in mice miR204—UCCCGGUAAUCCCUUACCUGGUU CCCUUCCUU
miR211—UCCCGGCUUUCCCUUACCUGGUUUUCCCCCUU		 Naked, IV
Wei et al., 2018 [42] miR668; cortex and medulla; ischemic AKI model in mice   Lipid-based transfection reagent; IV
Zhu et al., 2019 [45] miR199a-3p; tubular epithelial cells; ischemic model AKI in mice   Exosomes; IV
ASO Shi and Siemann [46] Vegf; Caki-I RCC cell line; xenograft model in mice CTCACCCGTCCATGAGCCCG Naked; IV
Daniel et al., 2003 [47] Tsp1; glomeruli; glomerulonephritis model in mice Tsp1-1—TTCTCCGTTGTGATTGAA
Tsp1-2—CACCTCCAATGAGTT		 Naked by electroporation or HVJ-liposomes; RA
Kausch et al., 2004 [48] Ki67; Renca cells; RCC orthotopic model in mice ACCAGGTGAGCCGAGGACGCCAT Naked, IP
Guha et al., 2007 [49] Ctgf; PTECs and mesangial cells; DN model in mice CCACAAGCTGTCCAGTCTAA Naked; SC
Wang et al., 2012 [50] Kras; tubular epithelial cells; UUO model in rats Kras-1—ATTCACATGACTATACACCT
Kras-2—CACACTTATTCCCTACTAGG		 Naked; SC
Ravichandran et al., 2014 [51] mTORC; tubular epithelial cells; PKD mouse model TCCACTTTTCACAGCACTGC Naked, IP
Ravichandran et al., 2015 [52] Agt; tubular epithelial cells; PKD mouse model TCTTCCACCCTGTCACAGCC Naked, IP
TFD Chae et al., 2006 [53] Sp1; tubulointerstitium; UUO model in rats GGGGCGGGGC HVJ-liposomes; RV
Tomita et al., 2007 [54] E2f; glomeruli; rats   HVJ-liposomes; RA
Aptamers Matsui et al., 2017 [55] RAGE; kidney, heart, eyes, testis; DN model in rats CCTGATATGGTGTCACCGCCGCCTTAGTATTGGTGTCTAC Naked; IP
Um et al., 2017 [56] Periostin; medulla; DN model in mice   PEG-conjugated; IP
Taguchi et al., 2018 [57] RAGE; glomeruli; hypertensive mouse model CATTCTTAGATTTTTGTCTCACTTAGGTGTAGATGGTGAT Naked; SC
Zhang et al., 2018 [58] RCC 786-O cells; xenograft model in mice ACTCATAGGGTTAGGGGCTGCTGGCCAGATATTCAGATGGTAGGGTTACTATGA Naked; IV

Abbreviations: proximal tubule epithelial cells (PTECs); distal tubule epithelial cells (DTECs); diabetic nephropathy (DN); unilateral ureteral obstruction (UUO); acute kidney injury (AKI); renal cell carcinoma (RCC); intravenous administration (IV); subcutaneous administration (SC); intraperitoneal administration (IP); Renal artery administration (RA); retrograde renal vein administration (RV); renal parenchyma administration (RP); retrograde ureteral administration (RU); nanoparticles (NPs); adeno-associated virus (AAV); hemagglutinating virus of Japan (HVJ); antisense oligonucleotide (ASO); transcription factor decoy (TFD); sequences that are not listed within the table were not specified or could not be found within the corresponding article, or are under the protection of a patent.

2.1. RNA-Based Strategies

2.1.1. siRNA

Short interference RNAs are short (20–27 nucleotides) double-stranded RNAs that target and degrade mRNA in a sequence-specific manner. The guide (antisense strand) is loaded onto Argonaute 2 protein (AGO2), forming the RNA induced silencing complex (RISC), whereas the sense strand is cleaved. The guide strand targets the specific mRNA by complete complementarity and AGO2 catalyzed mRNA cleavage. The RISC and guide strand can be recycled to target multiple mRNA molecules leading to efficient gene silencing [11][13][59]. Alternatively, siRNAs can also be designed to target long non-coding RNAs (lncRNAs), often involved in transcriptional repression, reversing the effects of this negative regulation [4]. siRNAs can sometimes be encoded in the form of short-hairpin RNAs (shRNAs), which are usually delivered to the cell by transduction with viral vectors and, in some cases, integrated into the host genome. shRNA is first expressed as a miRNA and processed into a siRNA duplex by the enzymes Drosha and Dicer, which then follows the same interference mechanism previously described [13]. Two siRNA-based therapies, Patisiran and Givosiran, have already been approved by the regulatory agencies in May 2020, both targeting the liver [4][5]. Interestingly, siRNA technology has also been explored for kidney diseases, showing potential as a therapeutic agent as well as contributing to the understanding of the molecular mechanisms of renal diseases (Table 1) [60]. One of the earliest studies successfully demonstrated the feasibility of using a siRNA-based therapy to ameliorate glomerular sclerosis in a mouse model of glomerulonephritis, by modulating the transforming growth factor beta (TGFβ) pathway as result of Mapk1 silencing [17]. Likewise, Morishita et al. [19] prevented renal fibrosis by using a siRNA against Smad4, suggesting it could be a crucial therapeutic target for renal fibrosis in vivo. Other studies using siRNA-based drugs have focused on reducing the extent of acute kidney injury (AKI), an unavoidable side effect of numerous medical treatments and surgical procedures which deprive the kidney of oxygen. For instance, Glebova et al. [61] evaluated the potential of 53 different siRNA targets, mainly related to apoptosis, inflammation and immune rejection pathways after ischemia-reperfusion caused by transplantation. This approach is still under development but has already shown promising results in a mouse model [22]. In a similar study, the authors effectively evaluated the prophylactic role of siRNA targeting meprin-1β and p53 expression in a cisplatin-induced murine model of AKI. These two proteins play key roles in depolarization and apoptosis after kidney injury [23]. Narváez et al. [25] also demonstrated that the administration of a siRNA therapy against Cd40 in a mouse model of AKI induced by unilateral ureteral obstruction (UUO) significantly reduced inflammation and promoted kidney repair. Importantly, upon demonstration of a lack of reduction in megalin protein expression in vivo using a siRNA, another recent study has pointed out that the use of siRNA-based therapies in kidney diseases might, indeed, be more suited to prevention of upregulation than reduction of constitutive baseline mRNA expression [24]. Although there is still scope for improvement, siRNA-based therapies in the kidney have shown promising results, especially in the prevention of AKI where some clinical trials have already been carried out [60].

2.1.2. saRNA

Small activating RNAs are double-stranded RNAs of 21 nucleotides in length that possess two nucleotide overhangs on both ends. Comparable to siRNA, saRNAs are loaded onto AGO2, where the sense strand in cleaved. Then, the saRNA–AGO2 complex is translocated to the nucleus, binding to complementary promoter regions and recruiting key elements for transcription initiation [62]. Thus, saRNA has an identical structure and chemical components as siRNA, but its biological function is the opposite of siRNA, since it acts to enhance gene transcription. The use of saRNA with therapeutic purposes has been recently tested in an in vivo model of ethylene glycol (EG)-induced calcium oxalate (CaOx) kidney crystal formation in rats. Using this approach, the authors significantly enhanced the expression of Trpv5, a key protein mediating calcium transport and reabsorption in the kidney, and achieved a reduction in CaOx crystal formation by promoting calcium reabsorption [34].

2.1.3. miRNA

miRNA constitute a class of single-stranded non-coding RNAs (ncRNAs) with a length of approximately 22 nucleotides after maturation. Their natural biogenesis starts in the nucleus, where they are transcribed as pri-miRNAs and cleaved into pre-miRNAs (~70 nucleotides in length) by a multiprotein complex mainly comprised of the Drosha and Dcrg8 proteins. Double-stranded pre-miRNAs are then exported to the cytoplasm and processed by Dicer into mature miRNAs (~22 nucleotides in length) [63]. For their mechanism of action, miRNAs are loaded onto AGO2 to form RISC, guiding the complex to its complementary binding site in the target transcript, commonly found in the 3′ untranslated region (UTR). In contrast with siRNAs, miRNAs typically bind with partial complementarity and usually promote translational repression by triggering mRNA decay through deadenylation and decapping. Different miRNAs can bind to the same transcript by overlapping or non-overlapping sites [11][13]. In general, there are three approaches to developing miRNA-based therapeutics: (1) anti-miRNA oligonucleotides (AMOs) or miRNA antagomirs, also known as antisense oligonucleotides (ASOs), which antagonize endogenous miRNAs by steric blocking of the miRNA within the RISC complex [4][11]; (2) miRNA sponges, which are genetically engineered competitive miRNA inhibitors designed by insertion in tandem of multiple binding sites of targets of analogous miRNAs or mRNAs [64]; (3) miRNA mimics, which are engineered double-stranded miRNAs that replace, improve or supplement the function of native miRNAs [11][59]; (4) target site blockers (TSB), designed to recognize and mask the regulatory sequences of miRNAs within a specific mRNA, with the potential to maintain the rest of the mRNA network unaffected [4].

miRNAs play an important role in the negative regulation of post-transcriptional gene expression. Consequently, aberrant miRNA expression is implicated in the development and progression of numerous diseases, and multiple families of miRNAs are shown to be dysregulated in kidney disease. The role of miRNAs in molecular pathology has already been reported in AKI and kidney transplantation [65][66], polycystic kidney disease (PKD) [67][68], and renal fibrosis [69][70], which represents the final outcome and most relevant pathological event of CKD. This, together with the fact that miRNAs can be detected in exosomes in plasma and urine, indicate them as suitable and attractive new biomarkers for diagnostic purposes and disease monitoring [71][72]. Importantly, up/downregulated miRNAs also represent novel therapeutic targets for kidney diseases, whose potential has already begun to be explored in animal models (Table 1). One of the earlier studies was carried out by Chau et al. [35], who successfully used an anti-miR21 antagomir, which limited injury and kidney fibrosis in two murine models of AKI. Similarly, renal fibrosis was also ameliorated by an anti-miR192 antagomir in a mouse model of diabetic nephropathy (DN) [36]. The use of miR204 and miR211 mimics has also proved effective at reducing the severity of kidney injury in a mouse model of systemic candidiasis [37] and inhibition of miR107 using an antagomir significantly prevented tubular cell injury in a mouse model of AKI induced by sepsis [39]. Moreover, the use of miRNA-based approaches has also shown potential in the treatment and understanding of the basis of ischemic-kidney injury, as demonstrated by a collection of recent studies (Table 1). One of the most common causes of ischemic AKI is transplantation. In that regard, a recent study has demonstrated the applicability of using antisense technology against the miR182-5p target to improve kidney function and morphology, employing a model of ischemic AKI in rats [40]. In addition, Wei et al. [41][42] elucidated the molecular mechanisms of miR489 and miR668 in the protection of the kidney during ischemia, indicating the possibility of using these miRNA or miRNA mimetics as therapeutic agents. Similarly, another study demonstrated the protective role of miR199a-3p in an ischemia-reperfusion model in vivo [45]. Taken together, these findings are promising for future evaluation of the clinical utility of miRNA mimetics and inhibitors targeting key pathologic renal pathways. However, translation of preclinical findings is sometimes complicated, as a deep understanding of the miRNA regulatory networks underlying the disease is needed. In some cases, targeting key points in the same network may prove more effective. Additionally, most miRNAs are regulated in a cell-type or organ-specific manner; thus, the possibility of off-target and undesired effects in unrelated organs is high. This problem could explain why few investigations using miRNAs-based therapies move forward to the clinical stage. In fact, only four miRNA-based therapies have reached clinical development, two of them dedicated to renal disease [66]. One of the drugs was developed for Alport nephropathy, a genetic disorder characterized by chronic glomerulonephritis that progresses to end-stage renal disease in young adult life. The antagomir against miR21 was effectively evaluated in a mouse model, where the animals displayed substantially milder disease and significantly improved survival after treatment [38]. The drug RG012 targeting miR21 is currently undergoing a phase 2 clinical trial (clinical trial identifier NCT02855268). The second drug is RGLS4326, an antagomir inhibiting miR17 developed for the treatment of autosomal dominant PKD (ADPKD), a genetic disorder caused by mutations in either PKD1 or PKD2 genes resulting in hyperproliferation of the renal tubular cells and cyst formation [43]. Treatment with RGLS4326 attenuated cyst growth in several PKD mouse models and human ADPKD models in vitro and is now in a phase 1 clinical trial (clinical trial identifier NCT04536688).

2.2. RNA/Protein-Based Strategies (CRISPR)

The development of the revolutionary CRISPR/Cas9 gene editing technology is driving the progress of RNA therapeutics forward in a similar way. This system, initially discovered as a form of acquired immunity in bacteria and archaea, consists of a protein (CRISPR-associated nuclease Cas9) and an oligonucleotide guide RNA (sgRNA). While the gRNA directs the nuclease to a specific genomic location adjacent to a protospacer adjacent motif (PAM) sequence, correct base-pairing activates Cas9 nuclease domains, which, cut the DNA, resulting in a double strand-break. In an attempt to repair the damage, eukaryotic cells can use two different mechanisms, nonhomologous end joining (NHEJ) and homology-directed repair (HDR). The NHEJ repair mechanism is prone to introduce small insertion or deletion errors, causing frameshift mutations and leading to gene knockout by disruption of the open reading frame. Conversely, when a donor template is introduced, it can be utilized by the HDR mechanism and harnessed to introduce a new sequence bearing a mutational correction or sequence knock-in in the desired loci [73][74]. A great advantage of the system, as consequence of its modularity, is that it allows for the testing of many different potential sgRNA while maintaining the protein component invariant. Importantly, although this system was initially developed to target DNA, RNA-targeting and interference has also been possible due to the development of new engineered nucleases such as Cas13 and RNA-targeting Cas9 (rCas9). Similarly, nuclease deficient Cas9 variants (dCas9) restricted from generating DNA breaks have been fused to transcriptional activation (VPR) [75], silencing proteins (KRAB) [76], or epigenetic modifiers [73][74], which can then be targeted to specific gene promoters, regulating gene expression. Catalytically inactive Cas9 and Cas13 variants have also been fused to other types of functional domains, such as base-pair editors or deaminases able to catalyze A-T to G-C transitions, allowing for single-base edition at the DNA and RNA level without the need to generate double or single-strand breaks [74], or reporter proteins, to visualize DNA or RNA [73]. Nonetheless, despite the fact that the CRISPR/Cas9 system has emerged as a promising platform with a wide variety of applications in biology research and therapeutics of human disease, efficient and safe delivery of its components to target cells in vivo remains challenging [77].

The use of the CRISPR/Cas9 system as a therapeutic approach for renal diseases has great potential, as a significant proportion of these diseases, such as autosomal dominant PKD or Alport syndrome, arise as consequence of genetic mutations. Nevertheless, gene editing in solid organs still faces the challenge of effective delivery to specific cells or tissues. Thus, the use of this tool in kidney research has so far been limited to its application in the development of novel in vitro (using human organoids) and in vivo models of renal disease. Such models are very useful in understanding the molecular mechanisms underlying renal diseases, as well as in the identification of new genes responsible for their progression and that could represent potential therapeutic targets [78][79]. Another exciting potential use of CRISPR/Cas9 technology is focused on expanding the available sources of kidneys for transplantation. Some authors have proposed the possibility of transplanting organs from other species such as pigs (xenotransplantation), an approach that, to this day, would lead to an extreme human immune response and rejection of the donor organ. However, CRISPR/Cas9 has appeared as a promising tool that could circumvent this limitation. In this direction, some authors have already employed CRISPR/Cas9 to genetically modify swine eggs in order to generate animals lacking carbohydrate xenoantigen, whose recognition by human and non-human primate antibodies was effectively diminished [80], or to generate I MHC null pigs [81]. The first demonstration of the feasibility of this approach was published by Higginbotham et al. [82], where the authors achieved effective pig-to-primate long-term transplantation (>125 days).

References

  1. Li, P.K.T.; Garcia-Garcia, G.; Lui, S.F.; Andreoli, S.; Fung, W.W.S.; Hradsky, A.; Kumaraswami, L.; Liakopoulos, V.; Rakhimova, Z.; Saadi, G.; et al. Kidney Health for Everyone Everywhere: From Prevention to Detection and Equitable Access to Care. Am. J. Hypertens 2020, 33, 282–289.
  2. Devuyst, O.; Knoers, N.V.A.M.; Remuzzi, G.; Schaefer, F. Rare inherited kidney diseases: Challenges, opportunities, and perspectives. Lancet 2014, 383, 1844–1859.
  3. Augustine, J. Kidney transplant: New opportunities and challenges. Cleve Clin. J. Med. 2018, 85, 138–144.
  4. Roberts, T.C.; Langer, R.; Wood, M.J.A. Advances in oligonucleotide drug delivery. Nat. Rev. Drug Discov. 2020, 19, 673–694.
  5. Dhuri, K.; Bechtold, C.; Quijano, E.; Pham, H.; Gupta, A.; Vikram, A.; Bahal, R. Antisense Oligonucleotides: An Emerging Area in Drug Discovery and Development. J. Clin. Med. 2020, 9, 2004.
  6. Grimm, D.; Streetz, K.L.; Jopling, C.L.; Storm, T.A.; Pandey, K.; Davis, C.R.; Marion, P.; Salazar, F.; Kay, M.A. Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature 2006, 441, 537–541.
  7. McCaffrey, A.P. RNA interference inhibitors of hepatitis B virus. In Proceedings of the Annals of the New York Academy of Sciences; Blackwell Publishing Inc.: Hoboken, NJ, USA, 2009; Volume 1175, pp. 15–23.
  8. Jackson, A.L.; Linsley, P.S. Noise amidst the silence: Off-target effects of siRNAs? Trends Genet. 2004, 20, 521–524.
  9. Anderson, E.; Boese, Q.; Khvorova, A.; Karpilow, J. Identifying siRNA-induced off-targets by microarray analysis. Methods Mol. Biol. 2008, 442, 45–63.
  10. Yoshida, T.; Naito, Y.; Yasuhara, H.; Sasaki, K.; Kawaji, H.; Kawai, J.; Naito, M.; Okuda, H.; Obika, S.; Inoue, T. Evaluation of off-target effects of gapmer antisense oligonucleotides using human cells. Genes Cells 2019, 24, 827–835.
  11. Edvard Smith, C.I.; Zain, R. Therapeutic oligonucleotides: State of the art. Annu. Rev. Pharmacol. Toxicol. 2018, 59, 605–630.
  12. Zhu, G.; Chen, X. Aptamer-based targeted therapy. Adv. Drug Deliv. Rev. 2018, 134, 65–78.
  13. Bajan, S.; Hutvagner, G. RNA-Based Therapeutics: From Antisense Oligonucleotides to miRNAs. Cells 2020, 9, 137.
  14. Geary, R.S.; Norris, D.; Yu, R.; Bennett, C.F. Pharmacokinetics, biodistribution and cell uptake of antisense oligonucleotides. Adv. Drug Deliv. Rev. 2015, 87, 46–51.
  15. Molitoris, B.A.; Dagher, P.C.; Sandoval, R.M.; Campos, S.B.; Ashush, H.; Fridman, E.; Brafman, A.; Faerman, A.; Atkinson, S.J.; Thompson, J.D.; et al. siRNA targeted to p53 attenuates ischemic and cisplatin-induced acute kidney injury. J. Am. Soc. Nephrol. 2009, 20, 1754–1764.
  16. Takabatake, Y.; Isaka, Y.; Imai, E. In vivo Transfer of Small Interfering RNA or Small Hairpin RNA Targeting Glomeruli. In Methods in Molecular Biology (Clifton, N.J.); Humana Press: Totowa, NJ, USA, 2009; Volume 466, pp. 251–263.
  17. Shimizu, H.; Hori, Y.; Kaname, S.; Yamada, K.; Nishiyama, N.; Matsumoto, S.; Miyata, K.; Oba, M.; Yamada, A.; Kataoka, K.; et al. SiRNA-based therapy ameliorates glomerulonephritis. J. Am. Soc. Nephrol. 2010, 21, 622–633.
  18. Gao, S.; Hein, S.; Dagnæs-Hansen, F.; Weyer, K.; Yang, C.; Nielsen, R.; Christensen, E.I.; Fenton, R.A.; Kjems, J. Megalin-mediated specific uptake of chitosan/siRNA nanoparticles in mouse kidney proximal tubule epithelial cells enables AQP1 gene silencing. Theranostics 2014, 4, 1039–1051.
  19. Morishita, Y.; Yoshizawa, H.; Watanabe, M.; Ishibashi, K.; Muto, S.; Kusano, E.; Nagata, D. SiRNAs targeted to Smad4 prevent renal fibrosis in vivo. Sci. Rep. 2014, 4.
  20. Yang, C.; Nilsson, L.; Cheema, M.U.; Wang, Y.; Frøkiær, J.; Gao, S.; Kjems, J.; Nørregaard, R. Chitosan/siRNA nanoparticles targeting cyclooxygenase type 2 attenuate unilateral ureteral obstruction-induced kidney injury in mice. Theranostics 2015, 5, 110–123.
  21. Zuckerman, J.E.; Gale, A.; Wu, P.; Ma, R.; Davis, M.E. SiRNA delivery to the glomerular mesangium using polycationic cyclodextrin nanoparticles containing siRNA. Nucleic Acid Ther. 2015, 25, 53–64.
  22. Zheng, X.; Zang, G.Y.; Jiang, J.; He, W.; Johnston, N.J.; Ling, H.; Chen, R.; Zhang, X.; Liu, Y.; Haig, A.; et al. Attenuating ischemia-reperfusion injury in kidney transplantation by perfusing donor organs with siRNA cocktail solution. Transplantation 2016, 100, 743–752.
  23. Alidori, S.; Akhavein, N.; Thorek, D.L.J.; Behling, K.; Romin, Y.; Queen, D.; Beattie, B.J.; Manova-Todorova, K.; Bergkvist, M.; Scheinberg, D.A.; et al. Targeted fibrillar nanocarbon RNAi treatment of acute kidney injury. Sci. Transl. Med. 2016, 8.
  24. Eadon, M.T.; Cheng, Y.-H.; Hato, T.; Benson, E.A.; Ipe, J.; Collins, K.S.; De Luca, T.; El-Achkar, T.M.; Bacallao, R.L.; Skaar, T.C.; et al. In vivo siRNA Delivery and Rebound of Renal LRP2 in Mice. J. Drug Deliv. 2017, 2017, 1–12.
  25. Narváez, A.; Guiteras, R.; Sola, A.; Manonelles, A.; Morote, J.; Torras, J.; Grinyó, J.M.; Cruzado, J.M. SiRNA-silencing of CD40 attenuates unilateral ureteral obstruction-induced kidney injury in mice. PLoS ONE 2019, 14.
  26. Wang, Y.; Wu, Q.; Wang, J.; Li, L.; Sun, X.; Zhang, Z.; Zhang, L. Co-delivery of p38α MAPK and p65 siRNA by novel liposomal glomerulus-targeting nano carriers for effective immunoglobulin a nephropathy treatment. J. Control. Release 2020, 320, 457–468.
  27. Thai, H.B.D.; Kim, K.R.; Hong, K.T.; Voitsitskyi, T.; Lee, J.S.; Mao, C.; Ahn, D.R. Kidney-Targeted Cytosolic Delivery of siRNA Using a Small-Sized Mirror DNA Tetrahedron for Enhanced Potency. ACS Cent. Sci. 2020.
  28. Wang, X.; Skelley, L.; Cade, R.; Sun, Z. AAV delivery of mineralocorticoid receptor shRNA prevents progression of cold-induced hypertension and attenuates renal damage. Gene Ther. 2006, 13, 1097–1103.
  29. Shou, Z.; Xiao, H.; Xu, Y.; Wang, Y.; Yang, Y.; Jiang, H.; Chen, J.; Yamada, K.; Miyamoto, K. SHARP-2 gene silencing by lentiviral-based short hairpin RNA interference prolonged rat kidney transplant recipients’ survival time. J. Int. Med. Res. 2009, 37, 766–778.
  30. Zhou, C.; Shan, Y.; Zhao, H.; He, P. Biological effects of lentivirus-mediated shRNA targeting collagen type i on the mesangial cells of rats. Ren. Fail. 2011, 33, 334–340.
  31. Fujino, T.; Muhib, S.; Sato, N.; Hasebe, N. Silencing of p53 RNA through transarterial delivery ameliorates renal tubular injury and downregulates GSK-3β expression after ischemia-reperfusion injury. Am. J. Physiol. Ren. Physiol. 2013, 305.
  32. Espana-Agusti, J.; Tuveson, D.A.; Adams, D.J.; Matakidou, A. A minimally invasive, lentiviral based method for the rapid and sustained genetic manipulation of renal tubules. Sci. Rep. 2015, 5.
  33. Xu, D.; Chen, P.; Zheng, P.; Yin, F.; Cheng, Q.; Zhou, Z.; Xie, H.; Li, J.; Ni, J.; Wang, Y.; et al. KLF4 initiates sustained YAP activation to promote renal fibrosis in mice after ischemia-reperfusion kidney injury. Acta Pharmacol. Sin. 2020.
  34. Zeng, T.; Duan, X.; Zhu, W.; Liu, Y.; Wu, W.; Zeng, G. SaRNA-mediated activation of TRPV5 reduces renal calcium oxalate deposition in rat via decreasing urinary calcium excretion. Urolithiasis 2018, 46, 271–278.
  35. Chau, B.N.; Xin, C.; Hartner, J.; Ren, S.; Castano, A.P.; Linn, G.; Li, J.; Tran, P.T.; Kaimal, V.; Huang, X.; et al. MicroRNA-21 promotes fibrosis of the kidney by silencing metabolic pathways. Sci. Transl. Med. 2012, 4, 121ra18.
  36. Putta, S.; Lanting, L.; Sun, G.; Lawson, G.; Kato, M.; Natarajan, R. Inhibiting microRNA-192 ameliorates renal fibrosis in diabetic nephropathy. J. Am. Soc. Nephrol. 2012, 23, 458–469.
  37. Li, X.Y.; Zhang, K.; Jiang, Z.Y.; Cai, L.H. MiR-204/miR-211 downregulation contributes to Candidemia-induced kidney injuries via derepression of Hmx1 expression. Life Sci. 2014, 102, 139–144.
  38. Gomez, I.G.; MacKenna, D.A.; Johnson, B.G.; Kaimal, V.; Roach, A.M.; Ren, S.; Nakagawa, N.; Xin, C.; Newitt, R.; Pandya, S.; et al. Anti-microRNA-21 oligonucleotides prevent Alport nephropathy progression by stimulating metabolic pathways. J. Clin. Invest. 2015, 125, 141–156.
  39. Wang, S.; Zhang, Z.; Wang, J.; Miao, H. MiR-107 induces TNF-α secretion in endothelial cells causing tubular cell injury in patients with septic acute kidney injury. Biochem. Biophys. Res. Commun. 2017, 483, 45–51.
  40. Wilflingseder, J.; Jelencsics, K.; Bergmeister, H.; Sunzenauer, J.; Regele, H.; Eskandary, F.; Reindl-Schwaighofer, R.; Kainz, A.; Oberbauer, R. miR-182-5p Inhibition Ameliorates Ischemic Acute Kidney Injury. Am. J. Pathol. 2017, 187, 70–79.
  41. Wei, Q.; Liu, Y.; Liu, P.; Hao, J.; Liang, M.; Mi, Q.S.; Chen, J.K.; Dong, Z. MicroRNA-489 induction by hypoxia-inducible factor-1 protects against ischemic kidney injury. J. Am. Soc. Nephrol. 2016, 27, 2784–2796.
  42. Wei, Q.; Sun, H.; Song, S.; Liu, Y.; Liu, P.; Livingston, M.J.; Wang, J.; Liang, M.; Mi, Q.S.; Huo, Y.; et al. MicroRNA-668 represses MTP18 to preserve mitochondrial dynamics in ischemic acute kidney injury. J. Clin. Invest. 2018, 128, 5448–5464.
  43. Lee, E.C.; Valencia, T.; Allerson, C.; Schairer, A.; Flaten, A.; Yheskel, M.; Kersjes, K.; Li, J.; Gatto, S.; Takhar, M.; et al. Discovery and preclinical evaluation of anti-miR-17 oligonucleotide RGLS4326 for the treatment of polycystic kidney disease. Nat. Commun. 2019, 10, 4148.
  44. Luan, J.; Fu, J.; Wang, D.; Jiao, C.; Cui, X.; Chen, C.; Liu, D.; Zhang, Y.; Wang, Y.; Yuen, P.S.T.; et al. miR-150-Based RNA Interference Attenuates Tubulointerstitial Fibrosis through the SOCS1/JAK/STAT Pathway In vivo and In Vitro. Mol. Ther. Nucleic Acids 2020, 22, 871–884.
  45. Zhu, G.; Pei, L.; Lin, F.; Yin, H.; Li, X.; He, W.; Liu, N.; Gou, X. Exosomes from human-bone-marrow-derived mesenchymal stem cells protect against renal ischemia/reperfusion injury via transferring miR-199a-3p. J. Cell. Physiol. 2019, 234, 23736–23749.
  46. Shi, W.; Siemann, D.W. Inhibition of renal cell carcinoma angiogenesis and growth by antisense oligonucleotides targeting vascular endothelial growth factor. Br. J. Cancer 2002, 87, 119–126.
  47. Daniel, C.; Takabatake, Y.; Mizui, M.; Isaka, Y.; Kawashi, H.; Rupprecht, H.; Imai, E.; Hugo, C. Antisense oligonucleotides against thrombospondin-1 inhibit activation of TGF-β in fibrotic renal disease in the rat in vivo. Am. J. Pathol. 2003, 163, 1185–1192.
  48. Kausch, I.; Jiang, H.; Brocks, C.; Bruderek, K.; Krüger, S.; Sczakiel, G.; Jocham, D.; Böhle, A. Ki-67-directed antisense therapy in an orthotopic renal cell carcinoma model. Eur. Urol. 2004, 46, 118–125.
  49. Guha, M.; Xu, Z.; Tung, D.; Lanting, L.; Natarajan, R. Specific down-regulation of connective tissue growth factor attenuates progression of nephropathy in mouse models of type 1 and type 2 diabetes. FASEB J. 2007, 21, 3355–3368.
  50. Wang, J.H.; Newbury, L.J.; Knisely, A.S.; Monia, B.; Hendry, B.M.; Sharpe, C.C. Antisense knockdown of Kras inhibits fibrosis in a rat model of unilateral ureteric obstruction. Am. J. Pathol. 2012, 180, 82–90.
  51. Ravichandran, K.; Zafar, I.; He, Z.; Doctor, R.B.; Moldovan, R.; Mullick, A.E.; Edelstein, C.L. An mTOR anti-sense oligonucleotide decreases polycystic kidney disease in mice with a targeted mutation in Pkd2. Hum. Mol. Genet. 2014, 23, 4919–4931.
  52. Ravichandran, K.; Ozkok, A.; Wang, Q.; Mullick, A.E.; Edelstein, C.L. Antisense-mediated angiotensinogen inhibition slows polycystic kidney disease in mice with a targeted mutation in Pkd2. Am. J. Physiol. Ren. Physiol. 2015, 308, F349–F357.
  53. Chae, Y.M.; Park, K.K.; Lee, I.K.; Kim, J.K.; Kim, C.H.; Chang, Y.C. Ring-Sp1 decoy oligonucleotide effectively suppresses extracellular matrix gene expression and fibrosis of rat kidney induced by unilateral ureteral obstruction. Gene Ther. 2006, 13, 430–439.
  54. Tomita, N.; Kashihara, N.; Morishita, R. Transcription factor decoy oligonucleotide-based therapeutic strategy for renal disease. Clin. Exp. Nephrol. 2007, 11, 7–17.
  55. Matsui, T.; Higashimoto, Y.; Nishino, Y.; Nakamura, N.; Fukami, K.; Yamagishi, S.I. RAGE-aptamer blocks the development and progression of experimental diabetic nephropathy. Diabetes 2017, 66, 1683–1695.
  56. Um, J.E.; Park, J.T.; Nam, B.Y.; Lee, J.P.; Jung, J.H.; Kim, Y.; Kim, S.; Park, J.; Wu, M.; Han, S.H.; et al. Periostin-binding DNA aptamer treatment attenuates renal fibrosis under diabetic conditions. Sci. Rep. 2017, 7.
  57. Taguchi, K.; Yamagishi, S.I.; Yokoro, M.; Ito, S.; Kodama, G.; Kaida, Y.; Nakayama, Y.; Ando, R.; Yamada-Obara, N.; Asanuma, K.; et al. RAGE-aptamer attenuates deoxycorticosterone acetate/salt-induced renal injury in mice. Sci. Rep. 2018, 8, s41598-s018.
  58. Zhang, H.; Wang, Z.; Xie, L.; Zhang, Y.; Deng, T.; Li, J.; Liu, J.; Xiong, W.; Zhang, L.; Zhang, L.; et al. Molecular Recognition and In-Vitro-Targeted Inhibition of Renal Cell Carcinoma Using a DNA Aptamer. Mol. Ther. Nucleic Acids 2018, 12, 758–768.
  59. Dammes, N.; Peer, D. Paving the Road for RNA Therapeutics. Trends Pharmacol. Sci. 2020, 41, 755–775.
  60. Yang, C.; Zhang, C.; Zhao, Z.; Zhu, T.; Yang, B. Fighting against kidney diseases with small interfering RNA: Opportunities and challenges. J. Transl. Med. 2015, 13, 1–12.
  61. Glebova, K.; Reznik, O.N.; Reznik, A.O.; Mehta, R.; Galkin, A.; Baranova, A.; Skoblov, M. siRNA technology in kidney transplantation: Current status and future potential. BioDrugs 2014, 28, 345–361.
  62. Kwok, A.; Raulf, N.; Habib, N. Developing small activating RNA as a therapeutic: Current challenges and promises. Ther. Deliv. 2019, 10, 151–164.
  63. Petrillo, F.; Iervolino, A.; Zacchia, M.; Simeoni, A.; Masella, C.; Capolongo, G.; Perna, A.; Capasso, G.; Trepiccione, F. MicroRNAs in Renal Diseases: A Potential Novel Therapeutic Target. Kidney Dis. 2017, 3, 111–119.
  64. Schena, F.P.; Serino, G.; Sallustio, F. MicroRNAs in kidney diseases: New promising biomarkers for diagnosis and monitoring. Nephrol. Dial. Transplant. 2014, 29, 755–763.
  65. Ledeganck, K.J.; Gielis, E.M.; Abramowicz, D.; Van Craenenbroeck, A.H.; Stenvinkel, P.; Shiels, P.G. MicroRNAs in AKI and kidney transplantation. Clin. J. Am. Soc. Nephrol. 2019, 14, 454–468.
  66. Brandenburger, T.; Lorenzen, J.M. Diagnostic and Therapeutic Potential of microRNAs in Acute Kidney Injury. Front. Pharmacol. 2020, 11.
  67. Ramalingam, H.; Yheskel, M.; Patel, V. Modulation of polycystic kidney disease by non-coding RNAs. Cell. Signal. 2020, 71.
  68. Li, D.; Sun, L. MicroRNAs and Polycystic Kidney Disease. Kidney Med. 2020, 2, 762–770.
  69. Fan, Y.; Chen, H.; Huang, Z.; Zheng, H.; Zhou, J. Emerging role of miRNAs in renal fibrosis. RNA Biol. 2020, 17, 1–12.
  70. Lv, W.; Fan, F.; Wang, Y.; Gonzalez-Fernandez, E.; Wang, C.; Yang, L.; Booz, G.W.; Roman, R.J. Therapeutic potential of microRNAs for the treatment of renal fibrosis and CKD. Physiol. Genom. 2018, 50, 20–34.
  71. Peters, L.J.F.; Floege, J.; Biessen, E.A.L.; Jankowski, J.; van der Vorst, E.P.C. Micrornas in chronic kidney disease: Four candidates for clinical application. Int. J. Mol. Sci. 2020, 21, 6547.
  72. Sun, I.O.; Lerman, L.O. Urinary microRNA in kidney disease: Utility and roles. Am. J. Physiol. Ren. Physiol. 2019, 316, F785–F793.
  73. Knott, G.J.; Doudna, J.A. CRISPR-Cas guides the future of genetic engineering. Science 2018, 361, 866–869.
  74. Anzalone, A.V.; Koblan, L.W.; Liu, D.R. Genome editing with CRISPR–Cas nucleases, base editors, transposases and prime editors. Nat. Biotechnol. 2020, 38, 824–844.
  75. Chavez, A.; Scheiman, J.; Vora, S.; Pruitt, B.W.; Tuttle, M.; Eswar, P.R.; Iyer, E.; Lin, S.; Kiani, S.; Guzman, C.D.; et al. Highly efficient Cas9-mediated transcriptional programming. Nat. Methods 2015, 12, 326–328.
  76. Kiani, S.; Beal, J.; Ebrahimkhani, M.R.; Huh, J.; Hall, R.N.; Xie, Z.; Li, Y.; Weiss, R. CRISPR transcriptional repression devices and layered circuits in mammalian cells. Nat. Methods 2014, 11, 723–726.
  77. Wilbie, D.; Walther, J.; Mastrobattista, E. Delivery Aspects of CRISPR/Cas for in vivo Genome Editing. Acc. Chem. Res. 2019, 52, 1555–1564.
  78. Cruz, N.M.; Freedman, B.S. CRISPR Gene Editing in the Kidney. Am. J. Kidney Dis. 2018, 71, 874–883.
  79. Higashijima, Y.; Hirano, S.; Nangaku, M.; Nureki, O. Applications of the CRISPR-Cas9 system in kidney research. Kidney Int. 2017, 92, 324–335.
  80. Estrada, J.L.; Martens, G.; Li, P.; Adams, A.; Newell, K.A.; Ford, M.L.; Butler, J.R.; Sidner, R.; Tector, M.; Tector, J. Evaluation of human and non-human primate antibody binding to pig cells lacking GGTA1/CMAH/β4GalNT2 genes. Xenotransplantation 2015, 22, 194–202.
  81. Reyes, L.M.; Estrada, J.L.; Wang, Z.Y.; Blosser, R.J.; Smith, R.F.; Sidner, R.A.; Paris, L.L.; Blankenship, R.L.; Ray, C.N.; Miner, A.C.; et al. Creating Class I MHC–Null Pigs Using Guide RNA and the Cas9 Endonuclease. J. Immunol. 2014, 193, 5751–5757.
  82. Higginbotham, L.; Mathews, D.; Breeden, C.A.; Song, M.; Farris, A.B.; Larsen, C.P.; Ford, M.L.; Lutz, A.J.; Tector, M.; Newell, K.A.; et al. Pre-transplant antibody screening and anti-CD154 costimulation blockade promote long-term xenograft survival in a pig-to-primate kidney transplant model. Xenotransplantation 2015, 22, 221–230.
More
© Text is available under the terms and conditions of the Creative Commons Attribution (CC BY) license; additional terms may apply. By using this site, you agree to the Terms and Conditions and Privacy Policy.
Upload a video for this entry
Information
Subjects: Medicine, Research & Experimental
Contributor MDPI registered users' name will be linked to their SciProfiles pages. To register with us, please refer to https://encyclopedia.pub/register :
Fernando Carton
View Times: 415
Revisions: 2 times (View History)
Update Date: 31 Mar 2021
Table of Contents
    1000/1000
    Hot Most Recent
    Feedback